Incidental Mutation 'R1822:Akr1a1'
ID206452
Institutional Source Beutler Lab
Gene Symbol Akr1a1
Ensembl Gene ENSMUSG00000028692
Gene Namealdo-keto reductase family 1, member A1 (aldehyde reductase)
SynonymsAkr1a4, 2610201A18Rik
MMRRC Submission 039850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R1822 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116636510-116651680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116636653 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 310 (V310A)
Ref Sequence ENSEMBL: ENSMUSP00000030455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030455] [ENSMUST00000128059]
PDB Structure
High resolution structure of mouse aldehyde reductase (AKR1a4) in its apo-form [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030455
AA Change: V310A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030455
Gene: ENSMUSG00000028692
AA Change: V310A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 294 1.4e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128010
Predicted Effect probably benign
Transcript: ENSMUST00000128059
SMART Domains Protein: ENSMUSP00000114861
Gene: ENSMUSG00000028692

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 16 204 3.7e-43 PFAM
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased osteoporosis in response to pregnancy or castration in the absence of dietary ascorbate. Mice homozygous for a knock-out allele exhibit reduced asorbic acid levels and DL-glyceraldehyde, glucuronolactone and glucuronate reductase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abca8b G T 11: 109,957,075 T798K possibly damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adsl G T 15: 80,962,742 E70* probably null Het
Ahcyl2 A G 6: 29,768,584 probably benign Het
AI314180 A G 4: 58,805,539 probably null Het
Alpk3 T A 7: 81,076,931 C121* probably null Het
Amph T A 13: 18,948,455 I8N probably damaging Het
Ano2 G A 6: 125,863,457 A364T probably damaging Het
Apbb2 T C 5: 66,400,177 T314A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip A G 6: 136,587,260 T834A probably benign Het
Brca2 T G 5: 150,540,198 D1142E probably benign Het
Cap2 A G 13: 46,615,347 S210G probably benign Het
Capn2 C A 1: 182,472,960 E596D possibly damaging Het
Cdc27 A T 11: 104,522,822 S358R probably benign Het
Cdhr3 C T 12: 33,045,205 G622S probably null Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Crhr1 A T 11: 104,133,072 M1L probably benign Het
Csmd1 T C 8: 16,223,326 T831A probably damaging Het
Cwc22 T C 2: 77,924,659 probably benign Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Cyp4a31 T C 4: 115,566,613 probably null Het
Cytip A C 2: 58,134,146 S221A probably benign Het
Dagla G A 19: 10,263,186 R227C possibly damaging Het
Dhx57 A G 17: 80,253,085 probably null Het
Dnah2 A T 11: 69,514,804 D627E probably damaging Het
Dock8 A G 19: 25,161,058 E1249G probably benign Het
Dpysl3 A G 18: 43,342,328 V31A probably benign Het
Fan1 T C 7: 64,372,806 N233S probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Glipr1 T A 10: 111,996,860 M58L possibly damaging Het
Gm10509 C T 17: 21,690,858 P31S possibly damaging Het
Gm5070 T C 3: 95,411,044 noncoding transcript Het
Gramd1a T C 7: 31,142,573 N138S probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
Hmcn2 C T 2: 31,383,692 S1352L probably damaging Het
Hoxa5 G A 6: 52,202,732 T221I probably damaging Het
Hsd17b2 C A 8: 117,758,749 P317Q possibly damaging Het
Ifi213 T A 1: 173,589,842 S335C probably damaging Het
Izumo4 A T 10: 80,703,895 D156V probably damaging Het
Khnyn A T 14: 55,885,852 E21V probably damaging Het
Kmt2d C T 15: 98,861,780 G1199E unknown Het
Lipk T C 19: 34,039,091 W240R probably benign Het
Lpar5 A G 6: 125,081,415 D33G possibly damaging Het
Lrp11 A G 10: 7,596,197 D219G probably damaging Het
Lrrcc1 T C 3: 14,559,225 probably benign Het
Man2a1 T C 17: 64,740,842 C252R probably damaging Het
Map2k5 A G 9: 63,235,303 F354L possibly damaging Het
Mlh3 T C 12: 85,266,145 probably benign Het
Mmp28 A G 11: 83,444,219 I331T probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Nckap1 A G 2: 80,517,898 S898P possibly damaging Het
Nectin1 T A 9: 43,791,077 Y40* probably null Het
Neurl1a T A 19: 47,257,459 V493E probably benign Het
Ntf3 A C 6: 126,102,246 I99S probably benign Het
Olfr1115 T C 2: 87,252,710 S258P possibly damaging Het
Olfr1386 T A 11: 49,470,968 F272L probably benign Het
Olfr318 A T 11: 58,720,307 V247E probably damaging Het
Olfr365 C G 2: 37,201,980 H246Q probably damaging Het
Olfr406 A G 11: 74,270,240 T284A probably benign Het
Olfr421-ps1 C T 1: 174,152,214 R233C probably benign Het
Olfr94 A G 17: 37,196,831 probably benign Het
Otof G A 5: 30,378,710 T1343I probably benign Het
Otop2 A T 11: 115,324,628 Y125F probably benign Het
Pate3 G A 9: 35,646,105 T85I probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Phf11d T C 14: 59,356,329 H132R probably benign Het
Pik3c3 G A 18: 30,344,077 probably null Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prkdc G A 16: 15,759,605 D2372N probably damaging Het
Ptprq C T 10: 107,718,478 E129K probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Ralgapb T A 2: 158,492,452 V1027E probably damaging Het
Rita1 T C 5: 120,609,580 T218A possibly damaging Het
Rrh T A 3: 129,812,633 T218S probably damaging Het
Scaper C T 9: 55,859,900 A416T probably damaging Het
Scn3a A G 2: 65,484,372 L1115P probably damaging Het
Serpinb6e A T 13: 33,833,234 S268T probably damaging Het
Slc1a6 G A 10: 78,812,931 W495* probably null Het
Slc32a1 A G 2: 158,611,378 H46R probably benign Het
Slc37a1 C T 17: 31,300,431 probably benign Het
Slc6a5 T A 7: 49,956,425 W694R probably benign Het
Smarcd2 A T 11: 106,267,396 D113E probably benign Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Sspo A T 6: 48,492,886 Q4506L possibly damaging Het
Stam2 T A 2: 52,716,527 E115D probably damaging Het
Sult1c1 A T 17: 53,973,925 L50H probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Togaram1 T G 12: 64,995,635 V1156G probably damaging Het
Tpp1 T C 7: 105,749,647 T192A probably benign Het
Ttc37 C A 13: 76,130,288 H574N probably benign Het
Ush1c A G 7: 46,209,901 L498P probably damaging Het
Vit A C 17: 78,622,836 Q410P probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Zfp341 A G 2: 154,646,134 E839G possibly damaging Het
Zhx3 G A 2: 160,780,355 L631F probably benign Het
Zmpste24 T C 4: 121,087,316 E95G possibly damaging Het
Other mutations in Akr1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Akr1a1 APN 4 116637983 missense probably damaging 1.00
IGL03176:Akr1a1 APN 4 116639075 missense probably damaging 1.00
IGL03265:Akr1a1 APN 4 116637817 missense probably benign 0.42
R0480:Akr1a1 UTSW 4 116639847 missense possibly damaging 0.84
R0972:Akr1a1 UTSW 4 116640007 critical splice acceptor site probably null
R1649:Akr1a1 UTSW 4 116638020 missense probably damaging 1.00
R1711:Akr1a1 UTSW 4 116637974 critical splice donor site probably null
R1727:Akr1a1 UTSW 4 116641051 missense probably damaging 1.00
R4653:Akr1a1 UTSW 4 116637959 unclassified probably benign
R5377:Akr1a1 UTSW 4 116639895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGGGGACAATTTCGTC -3'
(R):5'- GGGCACATTATTCTAGCTAGCC -3'

Sequencing Primer
(F):5'- GGGACAATTTCGTCTCATGC -3'
(R):5'- ATTCTAGCTAGCCTGTGAAGTC -3'
Posted On2014-06-23