Incidental Mutation 'R1822:Ahcyl2'
ID206463
Institutional Source Beutler Lab
Gene Symbol Ahcyl2
Ensembl Gene ENSMUSG00000029772
Gene NameS-adenosylhomocysteine hydrolase-like 2
Synonyms
MMRRC Submission 039850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R1822 (G1)
Quality Score219
Status Validated
Chromosome6
Chromosomal Location29768011-29912310 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 29768584 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102995] [ENSMUST00000115242] [ENSMUST00000136031] [ENSMUST00000150365]
Predicted Effect unknown
Transcript: ENSMUST00000102995
AA Change: E16G
SMART Domains Protein: ENSMUSP00000100060
Gene: ENSMUSG00000029772
AA Change: E16G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 142 172 N/A INTRINSIC
AdoHcyase 186 611 4.47e-268 SMART
AdoHcyase_NAD 371 532 2.21e-103 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115242
AA Change: E16G
SMART Domains Protein: ENSMUSP00000110897
Gene: ENSMUSG00000029772
AA Change: E16G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 143 173 N/A INTRINSIC
AdoHcyase 187 612 4.47e-268 SMART
AdoHcyase_NAD 372 533 2.21e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143707
Predicted Effect unknown
Transcript: ENSMUST00000150365
AA Change: E16G
SMART Domains Protein: ENSMUSP00000134827
Gene: ENSMUSG00000029772
AA Change: E16G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166718
AA Change: E46G
SMART Domains Protein: ENSMUSP00000133136
Gene: ENSMUSG00000029772
AA Change: E46G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 20 48 N/A INTRINSIC
low complexity region 65 110 N/A INTRINSIC
low complexity region 173 203 N/A INTRINSIC
AdoHcyase 217 642 4.47e-268 SMART
AdoHcyase_NAD 402 563 2.21e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201282
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abca8b G T 11: 109,957,075 T798K possibly damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adsl G T 15: 80,962,742 E70* probably null Het
AI314180 A G 4: 58,805,539 probably null Het
Akr1a1 A G 4: 116,636,653 V310A probably benign Het
Alpk3 T A 7: 81,076,931 C121* probably null Het
Amph T A 13: 18,948,455 I8N probably damaging Het
Ano2 G A 6: 125,863,457 A364T probably damaging Het
Apbb2 T C 5: 66,400,177 T314A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip A G 6: 136,587,260 T834A probably benign Het
Brca2 T G 5: 150,540,198 D1142E probably benign Het
Cap2 A G 13: 46,615,347 S210G probably benign Het
Capn2 C A 1: 182,472,960 E596D possibly damaging Het
Cdc27 A T 11: 104,522,822 S358R probably benign Het
Cdhr3 C T 12: 33,045,205 G622S probably null Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Crhr1 A T 11: 104,133,072 M1L probably benign Het
Csmd1 T C 8: 16,223,326 T831A probably damaging Het
Cwc22 T C 2: 77,924,659 probably benign Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Cyp4a31 T C 4: 115,566,613 probably null Het
Cytip A C 2: 58,134,146 S221A probably benign Het
Dagla G A 19: 10,263,186 R227C possibly damaging Het
Dhx57 A G 17: 80,253,085 probably null Het
Dnah2 A T 11: 69,514,804 D627E probably damaging Het
Dock8 A G 19: 25,161,058 E1249G probably benign Het
Dpysl3 A G 18: 43,342,328 V31A probably benign Het
Fan1 T C 7: 64,372,806 N233S probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Glipr1 T A 10: 111,996,860 M58L possibly damaging Het
Gm10509 C T 17: 21,690,858 P31S possibly damaging Het
Gm5070 T C 3: 95,411,044 noncoding transcript Het
Gramd1a T C 7: 31,142,573 N138S probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
Hmcn2 C T 2: 31,383,692 S1352L probably damaging Het
Hoxa5 G A 6: 52,202,732 T221I probably damaging Het
Hsd17b2 C A 8: 117,758,749 P317Q possibly damaging Het
Ifi213 T A 1: 173,589,842 S335C probably damaging Het
Izumo4 A T 10: 80,703,895 D156V probably damaging Het
Khnyn A T 14: 55,885,852 E21V probably damaging Het
Kmt2d C T 15: 98,861,780 G1199E unknown Het
Lipk T C 19: 34,039,091 W240R probably benign Het
Lpar5 A G 6: 125,081,415 D33G possibly damaging Het
Lrp11 A G 10: 7,596,197 D219G probably damaging Het
Lrrcc1 T C 3: 14,559,225 probably benign Het
Man2a1 T C 17: 64,740,842 C252R probably damaging Het
Map2k5 A G 9: 63,235,303 F354L possibly damaging Het
Mlh3 T C 12: 85,266,145 probably benign Het
Mmp28 A G 11: 83,444,219 I331T probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Nckap1 A G 2: 80,517,898 S898P possibly damaging Het
Nectin1 T A 9: 43,791,077 Y40* probably null Het
Neurl1a T A 19: 47,257,459 V493E probably benign Het
Ntf3 A C 6: 126,102,246 I99S probably benign Het
Olfr1115 T C 2: 87,252,710 S258P possibly damaging Het
Olfr1386 T A 11: 49,470,968 F272L probably benign Het
Olfr318 A T 11: 58,720,307 V247E probably damaging Het
Olfr365 C G 2: 37,201,980 H246Q probably damaging Het
Olfr406 A G 11: 74,270,240 T284A probably benign Het
Olfr421-ps1 C T 1: 174,152,214 R233C probably benign Het
Olfr94 A G 17: 37,196,831 probably benign Het
Otof G A 5: 30,378,710 T1343I probably benign Het
Otop2 A T 11: 115,324,628 Y125F probably benign Het
Pate3 G A 9: 35,646,105 T85I probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Phf11d T C 14: 59,356,329 H132R probably benign Het
Pik3c3 G A 18: 30,344,077 probably null Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prkdc G A 16: 15,759,605 D2372N probably damaging Het
Ptprq C T 10: 107,718,478 E129K probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Ralgapb T A 2: 158,492,452 V1027E probably damaging Het
Rita1 T C 5: 120,609,580 T218A possibly damaging Het
Rrh T A 3: 129,812,633 T218S probably damaging Het
Scaper C T 9: 55,859,900 A416T probably damaging Het
Scn3a A G 2: 65,484,372 L1115P probably damaging Het
Serpinb6e A T 13: 33,833,234 S268T probably damaging Het
Slc1a6 G A 10: 78,812,931 W495* probably null Het
Slc32a1 A G 2: 158,611,378 H46R probably benign Het
Slc37a1 C T 17: 31,300,431 probably benign Het
Slc6a5 T A 7: 49,956,425 W694R probably benign Het
Smarcd2 A T 11: 106,267,396 D113E probably benign Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Sspo A T 6: 48,492,886 Q4506L possibly damaging Het
Stam2 T A 2: 52,716,527 E115D probably damaging Het
Sult1c1 A T 17: 53,973,925 L50H probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Togaram1 T G 12: 64,995,635 V1156G probably damaging Het
Tpp1 T C 7: 105,749,647 T192A probably benign Het
Ttc37 C A 13: 76,130,288 H574N probably benign Het
Ush1c A G 7: 46,209,901 L498P probably damaging Het
Vit A C 17: 78,622,836 Q410P probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Zfp341 A G 2: 154,646,134 E839G possibly damaging Het
Zhx3 G A 2: 160,780,355 L631F probably benign Het
Zmpste24 T C 4: 121,087,316 E95G possibly damaging Het
Other mutations in Ahcyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Ahcyl2 APN 6 29880557 missense probably benign 0.03
IGL03072:Ahcyl2 APN 6 29906501 splice site probably benign
IGL03195:Ahcyl2 APN 6 29906769 splice site probably benign
R0189:Ahcyl2 UTSW 6 29891243 missense probably benign 0.32
R0395:Ahcyl2 UTSW 6 29886168 missense probably damaging 1.00
R0555:Ahcyl2 UTSW 6 29890671 critical splice acceptor site probably benign
R0924:Ahcyl2 UTSW 6 29870628 unclassified probably null
R0930:Ahcyl2 UTSW 6 29870628 unclassified probably null
R1413:Ahcyl2 UTSW 6 29768587 utr 5 prime probably benign
R1446:Ahcyl2 UTSW 6 29891240 missense probably damaging 0.96
R1864:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R1865:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R3810:Ahcyl2 UTSW 6 29891261 missense probably benign 0.01
R4429:Ahcyl2 UTSW 6 29894875 missense probably damaging 1.00
R4932:Ahcyl2 UTSW 6 29890701 missense probably benign 0.22
R5019:Ahcyl2 UTSW 6 29859739 missense possibly damaging 0.96
R5032:Ahcyl2 UTSW 6 29768556 utr 5 prime probably benign
R5396:Ahcyl2 UTSW 6 29859698 intron probably benign
R5604:Ahcyl2 UTSW 6 29908367 missense probably damaging 1.00
R5817:Ahcyl2 UTSW 6 29890721 missense probably damaging 1.00
R5959:Ahcyl2 UTSW 6 29886174 missense probably damaging 1.00
R6159:Ahcyl2 UTSW 6 29908458 missense possibly damaging 0.81
R6531:Ahcyl2 UTSW 6 29886162 missense probably benign 0.41
R7025:Ahcyl2 UTSW 6 29908421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCGCACTACAGGTTCTGTG -3'
(R):5'- AGTACCTTCTTGACCGTGCG -3'

Sequencing Primer
(F):5'- TACAGGTTCTGTGGCGCCTC -3'
(R):5'- CTTCATGGCGGACGCTTGAG -3'
Posted On2014-06-23