Incidental Mutation 'R1822:Ntf3'
ID206470
Institutional Source Beutler Lab
Gene Symbol Ntf3
Ensembl Gene ENSMUSG00000049107
Gene Nameneurotrophin 3
SynonymsNT-3, Ntf-3, NT3
MMRRC Submission 039850-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1822 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126101412-126166910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 126102246 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 99 (I99S)
Ref Sequence ENSEMBL: ENSMUSP00000144828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050484] [ENSMUST00000112244] [ENSMUST00000204542]
Predicted Effect probably benign
Transcript: ENSMUST00000050484
AA Change: I86S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052302
Gene: ENSMUSG00000049107
AA Change: I86S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
NGF 145 250 1.19e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112244
AA Change: I99S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107863
Gene: ENSMUSG00000049107
AA Change: I99S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
NGF 158 263 1.19e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204542
AA Change: I99S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144828
Gene: ENSMUSG00000049107
AA Change: I99S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
NGF 158 263 1.19e-85 SMART
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
MGI Phenotype FUNCTION: This gene encodes a member of the neurotrophins that have a wide variety of functions in both neural and non-neural tissues. The encoded preproprotein undergoes proteolytic processing to generate a noncovalently linked homodimeric mature protein that can bind to the transmembrane receptor tyrosine kinases to initiate a series of signaling events. Mice lacking the encoded protein exhibit severe defects in the peripheral nervous system including a complete lack of spinal proprioceptive afferents and their peripheral sense organs. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of peripheral sensory and sympathetic neurons, lack of spinal propioceptive afferents and their sense organs, impaired suckling and movement, and postnatal lethality. Heterozygotes show mild defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abca8b G T 11: 109,957,075 T798K possibly damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adsl G T 15: 80,962,742 E70* probably null Het
Ahcyl2 A G 6: 29,768,584 probably benign Het
AI314180 A G 4: 58,805,539 probably null Het
Akr1a1 A G 4: 116,636,653 V310A probably benign Het
Alpk3 T A 7: 81,076,931 C121* probably null Het
Amph T A 13: 18,948,455 I8N probably damaging Het
Ano2 G A 6: 125,863,457 A364T probably damaging Het
Apbb2 T C 5: 66,400,177 T314A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip A G 6: 136,587,260 T834A probably benign Het
Brca2 T G 5: 150,540,198 D1142E probably benign Het
Cap2 A G 13: 46,615,347 S210G probably benign Het
Capn2 C A 1: 182,472,960 E596D possibly damaging Het
Cdc27 A T 11: 104,522,822 S358R probably benign Het
Cdhr3 C T 12: 33,045,205 G622S probably null Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Crhr1 A T 11: 104,133,072 M1L probably benign Het
Csmd1 T C 8: 16,223,326 T831A probably damaging Het
Cwc22 T C 2: 77,924,659 probably benign Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Cyp4a31 T C 4: 115,566,613 probably null Het
Cytip A C 2: 58,134,146 S221A probably benign Het
Dagla G A 19: 10,263,186 R227C possibly damaging Het
Dhx57 A G 17: 80,253,085 probably null Het
Dnah2 A T 11: 69,514,804 D627E probably damaging Het
Dock8 A G 19: 25,161,058 E1249G probably benign Het
Dpysl3 A G 18: 43,342,328 V31A probably benign Het
Fan1 T C 7: 64,372,806 N233S probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Glipr1 T A 10: 111,996,860 M58L possibly damaging Het
Gm10509 C T 17: 21,690,858 P31S possibly damaging Het
Gm5070 T C 3: 95,411,044 noncoding transcript Het
Gramd1a T C 7: 31,142,573 N138S probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
Hmcn2 C T 2: 31,383,692 S1352L probably damaging Het
Hoxa5 G A 6: 52,202,732 T221I probably damaging Het
Hsd17b2 C A 8: 117,758,749 P317Q possibly damaging Het
Ifi213 T A 1: 173,589,842 S335C probably damaging Het
Izumo4 A T 10: 80,703,895 D156V probably damaging Het
Khnyn A T 14: 55,885,852 E21V probably damaging Het
Kmt2d C T 15: 98,861,780 G1199E unknown Het
Lipk T C 19: 34,039,091 W240R probably benign Het
Lpar5 A G 6: 125,081,415 D33G possibly damaging Het
Lrp11 A G 10: 7,596,197 D219G probably damaging Het
Lrrcc1 T C 3: 14,559,225 probably benign Het
Man2a1 T C 17: 64,740,842 C252R probably damaging Het
Map2k5 A G 9: 63,235,303 F354L possibly damaging Het
Mlh3 T C 12: 85,266,145 probably benign Het
Mmp28 A G 11: 83,444,219 I331T probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Nckap1 A G 2: 80,517,898 S898P possibly damaging Het
Nectin1 T A 9: 43,791,077 Y40* probably null Het
Neurl1a T A 19: 47,257,459 V493E probably benign Het
Olfr1115 T C 2: 87,252,710 S258P possibly damaging Het
Olfr1386 T A 11: 49,470,968 F272L probably benign Het
Olfr318 A T 11: 58,720,307 V247E probably damaging Het
Olfr365 C G 2: 37,201,980 H246Q probably damaging Het
Olfr406 A G 11: 74,270,240 T284A probably benign Het
Olfr421-ps1 C T 1: 174,152,214 R233C probably benign Het
Olfr94 A G 17: 37,196,831 probably benign Het
Otof G A 5: 30,378,710 T1343I probably benign Het
Otop2 A T 11: 115,324,628 Y125F probably benign Het
Pate3 G A 9: 35,646,105 T85I probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Phf11d T C 14: 59,356,329 H132R probably benign Het
Pik3c3 G A 18: 30,344,077 probably null Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prkdc G A 16: 15,759,605 D2372N probably damaging Het
Ptprq C T 10: 107,718,478 E129K probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Ralgapb T A 2: 158,492,452 V1027E probably damaging Het
Rita1 T C 5: 120,609,580 T218A possibly damaging Het
Rrh T A 3: 129,812,633 T218S probably damaging Het
Scaper C T 9: 55,859,900 A416T probably damaging Het
Scn3a A G 2: 65,484,372 L1115P probably damaging Het
Serpinb6e A T 13: 33,833,234 S268T probably damaging Het
Slc1a6 G A 10: 78,812,931 W495* probably null Het
Slc32a1 A G 2: 158,611,378 H46R probably benign Het
Slc37a1 C T 17: 31,300,431 probably benign Het
Slc6a5 T A 7: 49,956,425 W694R probably benign Het
Smarcd2 A T 11: 106,267,396 D113E probably benign Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Sspo A T 6: 48,492,886 Q4506L possibly damaging Het
Stam2 T A 2: 52,716,527 E115D probably damaging Het
Sult1c1 A T 17: 53,973,925 L50H probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Togaram1 T G 12: 64,995,635 V1156G probably damaging Het
Tpp1 T C 7: 105,749,647 T192A probably benign Het
Ttc37 C A 13: 76,130,288 H574N probably benign Het
Ush1c A G 7: 46,209,901 L498P probably damaging Het
Vit A C 17: 78,622,836 Q410P probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Zfp341 A G 2: 154,646,134 E839G possibly damaging Het
Zhx3 G A 2: 160,780,355 L631F probably benign Het
Zmpste24 T C 4: 121,087,316 E95G possibly damaging Het
Other mutations in Ntf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:Ntf3 APN 6 126101860 missense probably damaging 0.99
IGL02982:Ntf3 APN 6 126102377 missense probably damaging 0.99
PIT4403001:Ntf3 UTSW 6 126101826 missense probably damaging 1.00
R0026:Ntf3 UTSW 6 126101805 missense probably damaging 1.00
R1219:Ntf3 UTSW 6 126102211 missense possibly damaging 0.93
R1666:Ntf3 UTSW 6 126102438 missense possibly damaging 0.70
R1920:Ntf3 UTSW 6 126102522 missense possibly damaging 0.46
R2255:Ntf3 UTSW 6 126101726 makesense probably null
R3888:Ntf3 UTSW 6 126102442 missense probably benign 0.18
R4196:Ntf3 UTSW 6 126102175 missense probably benign 0.41
R6707:Ntf3 UTSW 6 126164728 critical splice donor site probably null
R6983:Ntf3 UTSW 6 126101845 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCTCACTGTCACACACTG -3'
(R):5'- AAGGAGTTTGCCGGAAGACTC -3'

Sequencing Primer
(F):5'- ACTGAGTACTCTCCTCGGTGAC -3'
(R):5'- GCCGGAAGACTCTCTCAATTC -3'
Posted On2014-06-23