Incidental Mutation 'R1822:Slc1a6'
ID206487
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
MMRRC Submission 039850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1822 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 78812931 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 495 (W495*)
Ref Sequence ENSEMBL: ENSMUSP00000005490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490]
Predicted Effect probably null
Transcript: ENSMUST00000005490
AA Change: W495*
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: W495*

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Meta Mutation Damage Score 0.686 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abca8b G T 11: 109,957,075 T798K possibly damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adsl G T 15: 80,962,742 E70* probably null Het
Ahcyl2 A G 6: 29,768,584 probably benign Het
AI314180 A G 4: 58,805,539 probably null Het
Akr1a1 A G 4: 116,636,653 V310A probably benign Het
Alpk3 T A 7: 81,076,931 C121* probably null Het
Amph T A 13: 18,948,455 I8N probably damaging Het
Ano2 G A 6: 125,863,457 A364T probably damaging Het
Apbb2 T C 5: 66,400,177 T314A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip A G 6: 136,587,260 T834A probably benign Het
Brca2 T G 5: 150,540,198 D1142E probably benign Het
Cap2 A G 13: 46,615,347 S210G probably benign Het
Capn2 C A 1: 182,472,960 E596D possibly damaging Het
Cdc27 A T 11: 104,522,822 S358R probably benign Het
Cdhr3 C T 12: 33,045,205 G622S probably null Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Crhr1 A T 11: 104,133,072 M1L probably benign Het
Csmd1 T C 8: 16,223,326 T831A probably damaging Het
Cwc22 T C 2: 77,924,659 probably benign Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Cyp4a31 T C 4: 115,566,613 probably null Het
Cytip A C 2: 58,134,146 S221A probably benign Het
Dagla G A 19: 10,263,186 R227C possibly damaging Het
Dhx57 A G 17: 80,253,085 probably null Het
Dnah2 A T 11: 69,514,804 D627E probably damaging Het
Dock8 A G 19: 25,161,058 E1249G probably benign Het
Dpysl3 A G 18: 43,342,328 V31A probably benign Het
Fan1 T C 7: 64,372,806 N233S probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Glipr1 T A 10: 111,996,860 M58L possibly damaging Het
Gm10509 C T 17: 21,690,858 P31S possibly damaging Het
Gm5070 T C 3: 95,411,044 noncoding transcript Het
Gramd1a T C 7: 31,142,573 N138S probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
Hmcn2 C T 2: 31,383,692 S1352L probably damaging Het
Hoxa5 G A 6: 52,202,732 T221I probably damaging Het
Hsd17b2 C A 8: 117,758,749 P317Q possibly damaging Het
Ifi213 T A 1: 173,589,842 S335C probably damaging Het
Izumo4 A T 10: 80,703,895 D156V probably damaging Het
Khnyn A T 14: 55,885,852 E21V probably damaging Het
Kmt2d C T 15: 98,861,780 G1199E unknown Het
Lipk T C 19: 34,039,091 W240R probably benign Het
Lpar5 A G 6: 125,081,415 D33G possibly damaging Het
Lrp11 A G 10: 7,596,197 D219G probably damaging Het
Lrrcc1 T C 3: 14,559,225 probably benign Het
Man2a1 T C 17: 64,740,842 C252R probably damaging Het
Map2k5 A G 9: 63,235,303 F354L possibly damaging Het
Mlh3 T C 12: 85,266,145 probably benign Het
Mmp28 A G 11: 83,444,219 I331T probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Nckap1 A G 2: 80,517,898 S898P possibly damaging Het
Nectin1 T A 9: 43,791,077 Y40* probably null Het
Neurl1a T A 19: 47,257,459 V493E probably benign Het
Ntf3 A C 6: 126,102,246 I99S probably benign Het
Olfr1115 T C 2: 87,252,710 S258P possibly damaging Het
Olfr1386 T A 11: 49,470,968 F272L probably benign Het
Olfr318 A T 11: 58,720,307 V247E probably damaging Het
Olfr365 C G 2: 37,201,980 H246Q probably damaging Het
Olfr406 A G 11: 74,270,240 T284A probably benign Het
Olfr421-ps1 C T 1: 174,152,214 R233C probably benign Het
Olfr94 A G 17: 37,196,831 probably benign Het
Otof G A 5: 30,378,710 T1343I probably benign Het
Otop2 A T 11: 115,324,628 Y125F probably benign Het
Pate3 G A 9: 35,646,105 T85I probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Phf11d T C 14: 59,356,329 H132R probably benign Het
Pik3c3 G A 18: 30,344,077 probably null Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prkdc G A 16: 15,759,605 D2372N probably damaging Het
Ptprq C T 10: 107,718,478 E129K probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Ralgapb T A 2: 158,492,452 V1027E probably damaging Het
Rita1 T C 5: 120,609,580 T218A possibly damaging Het
Rrh T A 3: 129,812,633 T218S probably damaging Het
Scaper C T 9: 55,859,900 A416T probably damaging Het
Scn3a A G 2: 65,484,372 L1115P probably damaging Het
Serpinb6e A T 13: 33,833,234 S268T probably damaging Het
Slc32a1 A G 2: 158,611,378 H46R probably benign Het
Slc37a1 C T 17: 31,300,431 probably benign Het
Slc6a5 T A 7: 49,956,425 W694R probably benign Het
Smarcd2 A T 11: 106,267,396 D113E probably benign Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Sspo A T 6: 48,492,886 Q4506L possibly damaging Het
Stam2 T A 2: 52,716,527 E115D probably damaging Het
Sult1c1 A T 17: 53,973,925 L50H probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Togaram1 T G 12: 64,995,635 V1156G probably damaging Het
Tpp1 T C 7: 105,749,647 T192A probably benign Het
Ttc37 C A 13: 76,130,288 H574N probably benign Het
Ush1c A G 7: 46,209,901 L498P probably damaging Het
Vit A C 17: 78,622,836 Q410P probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Zfp341 A G 2: 154,646,134 E839G possibly damaging Het
Zhx3 G A 2: 160,780,355 L631F probably benign Het
Zmpste24 T C 4: 121,087,316 E95G possibly damaging Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78800174 missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78796222 missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78789048 missense probably benign 0.12
R2360:Slc1a6 UTSW 10 78812884 missense possibly damaging 0.91
R2939:Slc1a6 UTSW 10 78814614 makesense probably null
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78787889 missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78796269 critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78812887 missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
R7166:Slc1a6 UTSW 10 78812812 missense possibly damaging 0.96
R7292:Slc1a6 UTSW 10 78814604 missense possibly damaging 0.84
R7548:Slc1a6 UTSW 10 78814431 missense not run
Predicted Primers PCR Primer
(F):5'- GTTCAGTCTTTCCTCCCGGA -3'
(R):5'- AAGTTAGCTGGCTCTTGGAC -3'

Sequencing Primer
(F):5'- GGATTCCTGACTCTCTTCCCG -3'
(R):5'- TGGACAGAGACCTCCTATTCTGAATC -3'
Posted On2014-06-23