Incidental Mutation 'R1822:Togaram1'
ID206503
Institutional Source Beutler Lab
Gene Symbol Togaram1
Ensembl Gene ENSMUSG00000035614
Gene NameTOG array regulator of axonemal microtubules 1
SynonymsFam179b, A430041B07Rik
MMRRC Submission 039850-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R1822 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location64965804-65022573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 64995635 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1156 (V1156G)
Ref Sequence ENSEMBL: ENSMUSP00000070382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066296] [ENSMUST00000223166]
Predicted Effect probably damaging
Transcript: ENSMUST00000066296
AA Change: V1156G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070382
Gene: ENSMUSG00000035614
AA Change: V1156G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
TOG 339 574 3.38e-23 SMART
low complexity region 804 815 N/A INTRINSIC
low complexity region 988 1001 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1033 1041 N/A INTRINSIC
coiled coil region 1177 1206 N/A INTRINSIC
TOG 1251 1486 4.37e-8 SMART
TOG 1533 1776 1.53e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221400
Predicted Effect possibly damaging
Transcript: ENSMUST00000223166
AA Change: V1206G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abca8b G T 11: 109,957,075 T798K possibly damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adsl G T 15: 80,962,742 E70* probably null Het
Ahcyl2 A G 6: 29,768,584 probably benign Het
AI314180 A G 4: 58,805,539 probably null Het
Akr1a1 A G 4: 116,636,653 V310A probably benign Het
Alpk3 T A 7: 81,076,931 C121* probably null Het
Amph T A 13: 18,948,455 I8N probably damaging Het
Ano2 G A 6: 125,863,457 A364T probably damaging Het
Apbb2 T C 5: 66,400,177 T314A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip A G 6: 136,587,260 T834A probably benign Het
Brca2 T G 5: 150,540,198 D1142E probably benign Het
Cap2 A G 13: 46,615,347 S210G probably benign Het
Capn2 C A 1: 182,472,960 E596D possibly damaging Het
Cdc27 A T 11: 104,522,822 S358R probably benign Het
Cdhr3 C T 12: 33,045,205 G622S probably null Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Crhr1 A T 11: 104,133,072 M1L probably benign Het
Csmd1 T C 8: 16,223,326 T831A probably damaging Het
Cwc22 T C 2: 77,924,659 probably benign Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Cyp4a31 T C 4: 115,566,613 probably null Het
Cytip A C 2: 58,134,146 S221A probably benign Het
Dagla G A 19: 10,263,186 R227C possibly damaging Het
Dhx57 A G 17: 80,253,085 probably null Het
Dnah2 A T 11: 69,514,804 D627E probably damaging Het
Dock8 A G 19: 25,161,058 E1249G probably benign Het
Dpysl3 A G 18: 43,342,328 V31A probably benign Het
Fan1 T C 7: 64,372,806 N233S probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Glipr1 T A 10: 111,996,860 M58L possibly damaging Het
Gm10509 C T 17: 21,690,858 P31S possibly damaging Het
Gm5070 T C 3: 95,411,044 noncoding transcript Het
Gramd1a T C 7: 31,142,573 N138S probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
Hmcn2 C T 2: 31,383,692 S1352L probably damaging Het
Hoxa5 G A 6: 52,202,732 T221I probably damaging Het
Hsd17b2 C A 8: 117,758,749 P317Q possibly damaging Het
Ifi213 T A 1: 173,589,842 S335C probably damaging Het
Izumo4 A T 10: 80,703,895 D156V probably damaging Het
Khnyn A T 14: 55,885,852 E21V probably damaging Het
Kmt2d C T 15: 98,861,780 G1199E unknown Het
Lipk T C 19: 34,039,091 W240R probably benign Het
Lpar5 A G 6: 125,081,415 D33G possibly damaging Het
Lrp11 A G 10: 7,596,197 D219G probably damaging Het
Lrrcc1 T C 3: 14,559,225 probably benign Het
Man2a1 T C 17: 64,740,842 C252R probably damaging Het
Map2k5 A G 9: 63,235,303 F354L possibly damaging Het
Mlh3 T C 12: 85,266,145 probably benign Het
Mmp28 A G 11: 83,444,219 I331T probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Nckap1 A G 2: 80,517,898 S898P possibly damaging Het
Nectin1 T A 9: 43,791,077 Y40* probably null Het
Neurl1a T A 19: 47,257,459 V493E probably benign Het
Ntf3 A C 6: 126,102,246 I99S probably benign Het
Olfr1115 T C 2: 87,252,710 S258P possibly damaging Het
Olfr1386 T A 11: 49,470,968 F272L probably benign Het
Olfr318 A T 11: 58,720,307 V247E probably damaging Het
Olfr365 C G 2: 37,201,980 H246Q probably damaging Het
Olfr406 A G 11: 74,270,240 T284A probably benign Het
Olfr421-ps1 C T 1: 174,152,214 R233C probably benign Het
Olfr94 A G 17: 37,196,831 probably benign Het
Otof G A 5: 30,378,710 T1343I probably benign Het
Otop2 A T 11: 115,324,628 Y125F probably benign Het
Pate3 G A 9: 35,646,105 T85I probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Phf11d T C 14: 59,356,329 H132R probably benign Het
Pik3c3 G A 18: 30,344,077 probably null Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prkdc G A 16: 15,759,605 D2372N probably damaging Het
Ptprq C T 10: 107,718,478 E129K probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Ralgapb T A 2: 158,492,452 V1027E probably damaging Het
Rita1 T C 5: 120,609,580 T218A possibly damaging Het
Rrh T A 3: 129,812,633 T218S probably damaging Het
Scaper C T 9: 55,859,900 A416T probably damaging Het
Scn3a A G 2: 65,484,372 L1115P probably damaging Het
Serpinb6e A T 13: 33,833,234 S268T probably damaging Het
Slc1a6 G A 10: 78,812,931 W495* probably null Het
Slc32a1 A G 2: 158,611,378 H46R probably benign Het
Slc37a1 C T 17: 31,300,431 probably benign Het
Slc6a5 T A 7: 49,956,425 W694R probably benign Het
Smarcd2 A T 11: 106,267,396 D113E probably benign Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Sspo A T 6: 48,492,886 Q4506L possibly damaging Het
Stam2 T A 2: 52,716,527 E115D probably damaging Het
Sult1c1 A T 17: 53,973,925 L50H probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tpp1 T C 7: 105,749,647 T192A probably benign Het
Ttc37 C A 13: 76,130,288 H574N probably benign Het
Ush1c A G 7: 46,209,901 L498P probably damaging Het
Vit A C 17: 78,622,836 Q410P probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Zfp341 A G 2: 154,646,134 E839G possibly damaging Het
Zhx3 G A 2: 160,780,355 L631F probably benign Het
Zmpste24 T C 4: 121,087,316 E95G possibly damaging Het
Other mutations in Togaram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Togaram1 APN 12 65006399 missense probably damaging 1.00
IGL01128:Togaram1 APN 12 64980876 missense probably benign 0.01
IGL01406:Togaram1 APN 12 64995578 missense possibly damaging 0.81
IGL01534:Togaram1 APN 12 64966547 missense probably damaging 0.99
IGL01569:Togaram1 APN 12 64982662 missense possibly damaging 0.81
IGL01927:Togaram1 APN 12 64976702 missense probably benign 0.31
IGL02066:Togaram1 APN 12 64983421 missense probably damaging 1.00
IGL02746:Togaram1 APN 12 64966496 nonsense probably null
IGL02878:Togaram1 APN 12 64992626 missense possibly damaging 0.60
IGL02947:Togaram1 APN 12 65021500 missense probably damaging 1.00
IGL02961:Togaram1 APN 12 64966710 missense probably damaging 1.00
PIT4810001:Togaram1 UTSW 12 64983512 missense probably damaging 1.00
R0483:Togaram1 UTSW 12 65007031 missense probably damaging 1.00
R0519:Togaram1 UTSW 12 64966002 unclassified probably benign
R0584:Togaram1 UTSW 12 64967505 missense probably damaging 1.00
R0646:Togaram1 UTSW 12 65021466 missense probably damaging 1.00
R0749:Togaram1 UTSW 12 64982698 missense possibly damaging 0.87
R0891:Togaram1 UTSW 12 64982647 missense probably benign 0.01
R1111:Togaram1 UTSW 12 65006341 missense probably damaging 1.00
R1349:Togaram1 UTSW 12 65011145 missense probably damaging 0.99
R1531:Togaram1 UTSW 12 64966265 missense probably benign 0.01
R1618:Togaram1 UTSW 12 64967073 missense possibly damaging 0.47
R1672:Togaram1 UTSW 12 65021568 missense probably benign 0.00
R1789:Togaram1 UTSW 12 65002635 missense possibly damaging 0.47
R1930:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R1931:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R2006:Togaram1 UTSW 12 65019140 missense probably damaging 1.00
R2018:Togaram1 UTSW 12 65002659 missense possibly damaging 0.76
R2304:Togaram1 UTSW 12 64976856 splice site probably null
R2345:Togaram1 UTSW 12 65008632 missense probably benign 0.05
R2407:Togaram1 UTSW 12 64967670 missense probably damaging 1.00
R2853:Togaram1 UTSW 12 65016612 missense probably benign 0.40
R3123:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3124:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3125:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3693:Togaram1 UTSW 12 64983509 missense probably benign 0.34
R3857:Togaram1 UTSW 12 64980859 missense possibly damaging 0.64
R3870:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R3871:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R4398:Togaram1 UTSW 12 64980856 missense probably benign
R4578:Togaram1 UTSW 12 65020326 missense probably damaging 1.00
R4579:Togaram1 UTSW 12 64967907 missense probably damaging 1.00
R4621:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4623:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4655:Togaram1 UTSW 12 64967120 missense possibly damaging 0.91
R5080:Togaram1 UTSW 12 64983403 missense probably benign 0.02
R5459:Togaram1 UTSW 12 64967736 missense probably damaging 1.00
R5652:Togaram1 UTSW 12 65016650 missense probably benign 0.13
R5857:Togaram1 UTSW 12 64995557 missense possibly damaging 0.64
R5997:Togaram1 UTSW 12 64995538 missense probably benign 0.00
R6090:Togaram1 UTSW 12 64967801 missense probably benign 0.07
R6117:Togaram1 UTSW 12 64967487 missense probably damaging 1.00
R6221:Togaram1 UTSW 12 64966546 missense probably damaging 1.00
R6505:Togaram1 UTSW 12 64966590 missense possibly damaging 0.78
R6545:Togaram1 UTSW 12 64978207 missense possibly damaging 0.90
R6706:Togaram1 UTSW 12 65002609 missense probably benign 0.16
R7041:Togaram1 UTSW 12 65020386 missense possibly damaging 0.76
R7199:Togaram1 UTSW 12 64995518 missense probably benign
R7284:Togaram1 UTSW 12 65008680 missense probably benign 0.09
R7451:Togaram1 UTSW 12 64996975 missense probably damaging 1.00
X0021:Togaram1 UTSW 12 64966184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTAGAGTGCCATTACGTAACC -3'
(R):5'- ATGCAGGAACACATAGACAAGTTC -3'

Sequencing Primer
(F):5'- GAGTGCCATTACGTAACCAATAACTG -3'
(R):5'- TTAATCCCAGCACTTGGTAGGCAG -3'
Posted On2014-06-23