Incidental Mutation 'R1822:Pdpk1'
ID206518
Institutional Source Beutler Lab
Gene Symbol Pdpk1
Ensembl Gene ENSMUSG00000024122
Gene Name3-phosphoinositide dependent protein kinase 1
SynonymsPkb kinase, Pdk1
MMRRC Submission 039850-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1822 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24073680-24150924 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 24098176 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052462] [ENSMUST00000102927] [ENSMUST00000115407] [ENSMUST00000115409] [ENSMUST00000115411]
Predicted Effect probably benign
Transcript: ENSMUST00000052462
SMART Domains Protein: ENSMUSP00000061942
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
S_TKc 58 318 4.07e-97 SMART
low complexity region 364 380 N/A INTRINSIC
Pfam:PH_3 422 524 1.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102927
SMART Domains Protein: ENSMUSP00000099991
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 551 1.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115407
SMART Domains Protein: ENSMUSP00000111066
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115409
SMART Domains Protein: ENSMUSP00000111068
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
Pfam:Pkinase 110 217 3.6e-18 PFAM
low complexity region 264 280 N/A INTRINSIC
Pfam:PH_3 322 424 2.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115411
SMART Domains Protein: ENSMUSP00000111070
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 522 4.9e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147199
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit embryogenesis defects, impaired forebrain development, and die by mid gestation. Cardiac muscle-specific conditional mutants exhibit thin ventricular walls and die of heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abca8b G T 11: 109,957,075 T798K possibly damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adsl G T 15: 80,962,742 E70* probably null Het
Ahcyl2 A G 6: 29,768,584 probably benign Het
AI314180 A G 4: 58,805,539 probably null Het
Akr1a1 A G 4: 116,636,653 V310A probably benign Het
Alpk3 T A 7: 81,076,931 C121* probably null Het
Amph T A 13: 18,948,455 I8N probably damaging Het
Ano2 G A 6: 125,863,457 A364T probably damaging Het
Apbb2 T C 5: 66,400,177 T314A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip A G 6: 136,587,260 T834A probably benign Het
Brca2 T G 5: 150,540,198 D1142E probably benign Het
Cap2 A G 13: 46,615,347 S210G probably benign Het
Capn2 C A 1: 182,472,960 E596D possibly damaging Het
Cdc27 A T 11: 104,522,822 S358R probably benign Het
Cdhr3 C T 12: 33,045,205 G622S probably null Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Crhr1 A T 11: 104,133,072 M1L probably benign Het
Csmd1 T C 8: 16,223,326 T831A probably damaging Het
Cwc22 T C 2: 77,924,659 probably benign Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Cyp4a31 T C 4: 115,566,613 probably null Het
Cytip A C 2: 58,134,146 S221A probably benign Het
Dagla G A 19: 10,263,186 R227C possibly damaging Het
Dhx57 A G 17: 80,253,085 probably null Het
Dnah2 A T 11: 69,514,804 D627E probably damaging Het
Dock8 A G 19: 25,161,058 E1249G probably benign Het
Dpysl3 A G 18: 43,342,328 V31A probably benign Het
Fan1 T C 7: 64,372,806 N233S probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Glipr1 T A 10: 111,996,860 M58L possibly damaging Het
Gm10509 C T 17: 21,690,858 P31S possibly damaging Het
Gm5070 T C 3: 95,411,044 noncoding transcript Het
Gramd1a T C 7: 31,142,573 N138S probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
Hmcn2 C T 2: 31,383,692 S1352L probably damaging Het
Hoxa5 G A 6: 52,202,732 T221I probably damaging Het
Hsd17b2 C A 8: 117,758,749 P317Q possibly damaging Het
Ifi213 T A 1: 173,589,842 S335C probably damaging Het
Izumo4 A T 10: 80,703,895 D156V probably damaging Het
Khnyn A T 14: 55,885,852 E21V probably damaging Het
Kmt2d C T 15: 98,861,780 G1199E unknown Het
Lipk T C 19: 34,039,091 W240R probably benign Het
Lpar5 A G 6: 125,081,415 D33G possibly damaging Het
Lrp11 A G 10: 7,596,197 D219G probably damaging Het
Lrrcc1 T C 3: 14,559,225 probably benign Het
Man2a1 T C 17: 64,740,842 C252R probably damaging Het
Map2k5 A G 9: 63,235,303 F354L possibly damaging Het
Mlh3 T C 12: 85,266,145 probably benign Het
Mmp28 A G 11: 83,444,219 I331T probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Nckap1 A G 2: 80,517,898 S898P possibly damaging Het
Nectin1 T A 9: 43,791,077 Y40* probably null Het
Neurl1a T A 19: 47,257,459 V493E probably benign Het
Ntf3 A C 6: 126,102,246 I99S probably benign Het
Olfr1115 T C 2: 87,252,710 S258P possibly damaging Het
Olfr1386 T A 11: 49,470,968 F272L probably benign Het
Olfr318 A T 11: 58,720,307 V247E probably damaging Het
Olfr365 C G 2: 37,201,980 H246Q probably damaging Het
Olfr406 A G 11: 74,270,240 T284A probably benign Het
Olfr421-ps1 C T 1: 174,152,214 R233C probably benign Het
Olfr94 A G 17: 37,196,831 probably benign Het
Otof G A 5: 30,378,710 T1343I probably benign Het
Otop2 A T 11: 115,324,628 Y125F probably benign Het
Pate3 G A 9: 35,646,105 T85I probably benign Het
Phf11d T C 14: 59,356,329 H132R probably benign Het
Pik3c3 G A 18: 30,344,077 probably null Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prkdc G A 16: 15,759,605 D2372N probably damaging Het
Ptprq C T 10: 107,718,478 E129K probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Ralgapb T A 2: 158,492,452 V1027E probably damaging Het
Rita1 T C 5: 120,609,580 T218A possibly damaging Het
Rrh T A 3: 129,812,633 T218S probably damaging Het
Scaper C T 9: 55,859,900 A416T probably damaging Het
Scn3a A G 2: 65,484,372 L1115P probably damaging Het
Serpinb6e A T 13: 33,833,234 S268T probably damaging Het
Slc1a6 G A 10: 78,812,931 W495* probably null Het
Slc32a1 A G 2: 158,611,378 H46R probably benign Het
Slc37a1 C T 17: 31,300,431 probably benign Het
Slc6a5 T A 7: 49,956,425 W694R probably benign Het
Smarcd2 A T 11: 106,267,396 D113E probably benign Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Sspo A T 6: 48,492,886 Q4506L possibly damaging Het
Stam2 T A 2: 52,716,527 E115D probably damaging Het
Sult1c1 A T 17: 53,973,925 L50H probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Togaram1 T G 12: 64,995,635 V1156G probably damaging Het
Tpp1 T C 7: 105,749,647 T192A probably benign Het
Ttc37 C A 13: 76,130,288 H574N probably benign Het
Ush1c A G 7: 46,209,901 L498P probably damaging Het
Vit A C 17: 78,622,836 Q410P probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Zfp341 A G 2: 154,646,134 E839G possibly damaging Het
Zhx3 G A 2: 160,780,355 L631F probably benign Het
Zmpste24 T C 4: 121,087,316 E95G possibly damaging Het
Other mutations in Pdpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pdpk1 APN 17 24106861 missense possibly damaging 0.87
IGL01467:Pdpk1 APN 17 24088170 missense probably damaging 0.98
IGL02251:Pdpk1 APN 17 24079638 missense probably damaging 1.00
IGL03411:Pdpk1 APN 17 24101644 missense probably damaging 1.00
R0152:Pdpk1 UTSW 17 24106946 missense possibly damaging 0.93
R0610:Pdpk1 UTSW 17 24098171 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1817:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1819:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1823:Pdpk1 UTSW 17 24098176 splice site probably benign
R3783:Pdpk1 UTSW 17 24110850 missense possibly damaging 0.95
R4653:Pdpk1 UTSW 17 24106897 missense probably benign 0.25
R5000:Pdpk1 UTSW 17 24111045 missense possibly damaging 0.66
R5385:Pdpk1 UTSW 17 24098140 nonsense probably null
R5425:Pdpk1 UTSW 17 24098121 missense probably damaging 1.00
R5429:Pdpk1 UTSW 17 24091560 missense probably benign 0.01
R5642:Pdpk1 UTSW 17 24106855 nonsense probably null
R5936:Pdpk1 UTSW 17 24093229 missense probably damaging 1.00
R6049:Pdpk1 UTSW 17 24098135 nonsense probably null
R6332:Pdpk1 UTSW 17 24106922 missense probably damaging 0.99
R6693:Pdpk1 UTSW 17 24111126 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCACTGGATGGCTTTCTACC -3'
(R):5'- ATCCAGTATCTTTAGGGAGGGTCC -3'

Sequencing Primer
(F):5'- AGGGATTTATCACTGTACCAGGCTC -3'
(R):5'- CTTTGATGGCGCAGTCTATTCCAG -3'
Posted On2014-06-23