Incidental Mutation 'R1824:Abl1'
ID206637
Institutional Source Beutler Lab
Gene Symbol Abl1
Ensembl Gene ENSMUSG00000026842
Gene Namec-abl oncogene 1, non-receptor tyrosine kinase
Synonymsc-Abl, E430008G22Rik
MMRRC Submission 039852-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R1824 (G1)
Quality Score209
Status Not validated
Chromosome2
Chromosomal Location31688376-31804227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31800644 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 706 (M706K)
Ref Sequence ENSEMBL: ENSMUSP00000028190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028190] [ENSMUST00000075759] [ENSMUST00000142554]
PDB Structure
CRYSTAL STRUCTURE OF THE COMPLEX OF THE ABL TYROSINE KINASE SH3 DOMAIN WITH 3BP-1 SYNTHETIC PEPTIDE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE UNLIGANDED ABL TYROSINE KINASE SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF ABL KINASE DOMAIN IN COMPLEX WITH A SMALL MOLECULE INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE C-ABL KINASE DOMAIN IN COMPLEX WITH STI-571. [X-RAY DIFFRACTION]
Crystal Structure of the c-Abl Kinase domain in complex with PD173955 [X-RAY DIFFRACTION]
Structural basis for the auto-inhibition of c-Abl tyrosine kinase [X-RAY DIFFRACTION]
Structural basis for the auto-inhibition of c-Abl tyrosine kinase [X-RAY DIFFRACTION]
Abl kinase domain in complex with NVP-AFG210 [X-RAY DIFFRACTION]
Crystal Structure of Abl kinase bound with PPY-A [X-RAY DIFFRACTION]
Crystal Structure of the T315I Mutant of Abl kinase bound with PPY-A [X-RAY DIFFRACTION]
>> 11 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000028190
AA Change: M706K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028190
Gene: ENSMUSG00000026842
AA Change: M706K

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
SH3 64 120 6.95e-16 SMART
SH2 125 208 6.52e-32 SMART
TyrKc 242 493 4.48e-149 SMART
low complexity region 698 703 N/A INTRINSIC
low complexity region 802 810 N/A INTRINSIC
low complexity region 883 907 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 983 N/A INTRINSIC
FABD 997 1123 1.36e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075759
AA Change: M725K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000075167
Gene: ENSMUSG00000026842
AA Change: M725K

DomainStartEndE-ValueType
SH3 83 139 6.95e-16 SMART
SH2 144 227 6.52e-32 SMART
TyrKc 261 512 4.48e-149 SMART
low complexity region 717 722 N/A INTRINSIC
low complexity region 821 829 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
low complexity region 968 979 N/A INTRINSIC
low complexity region 983 1002 N/A INTRINSIC
FABD 1016 1142 1.36e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124726
Predicted Effect probably benign
Transcript: ENSMUST00000142554
SMART Domains Protein: ENSMUSP00000142123
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 47 2e-27 PDB
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have increased perinatal and postnatal mortality and may display foreshortened crania, abnormal development of spleen, head, heart and eye, reduced B and T cell populations, and osteoporosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,872,256 noncoding transcript Het
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Acd A G 8: 105,700,490 L96P probably damaging Het
Arsi T A 18: 60,912,297 W20R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asic3 C T 5: 24,413,751 Q14* probably null Het
Asxl3 T A 18: 22,522,068 I1045N probably damaging Het
Atr T C 9: 95,936,421 I2149T probably damaging Het
Begain A G 12: 109,033,099 probably null Het
Brca2 C T 5: 150,536,922 T554I possibly damaging Het
C130079G13Rik C A 3: 59,932,580 Y24* probably null Het
C1s2 C T 6: 124,635,682 V11I probably benign Het
Cacna1i T C 15: 80,376,789 F1333L possibly damaging Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cep164 C T 9: 45,778,928 V1367M probably damaging Het
Cfap46 C A 7: 139,639,602 A1316S probably benign Het
Cic T C 7: 25,288,266 S553P probably damaging Het
Clcn2 C T 16: 20,715,962 A12T probably benign Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Coil A G 11: 88,982,097 N428S possibly damaging Het
Cpxm1 A C 2: 130,395,697 V196G probably damaging Het
Cr2 A G 1: 195,157,316 V601A probably damaging Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Dclre1a T C 19: 56,546,718 probably null Het
Dennd4a G C 9: 64,859,358 probably null Het
Dlg5 T C 14: 24,149,444 H1464R probably benign Het
Dmac2 T G 7: 25,624,792 M225R probably damaging Het
Dnah8 T C 17: 30,731,180 V1991A possibly damaging Het
Dscam A C 16: 96,825,581 V376G probably benign Het
Dync1li1 A G 9: 114,709,184 D203G probably benign Het
Eva1c A G 16: 90,866,443 T22A probably benign Het
Fam110b A G 4: 5,799,029 D149G probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Fsip1 T C 2: 118,232,908 D360G probably damaging Het
Galnt14 T C 17: 73,709,939 T41A probably benign Het
Gdf3 T A 6: 122,609,962 Q2L probably benign Het
Glrp1 A G 1: 88,509,789 probably null Het
Gm3336 C G 8: 70,720,417 probably null Het
Gm8674 C T 13: 49,900,808 noncoding transcript Het
Gnat1 A G 9: 107,676,575 Y226H probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H1foo A G 6: 115,948,758 Y1C probably null Het
Ick T A 9: 78,157,862 D351E probably benign Het
Igfbpl1 C A 4: 45,826,406 A130S probably benign Het
Impdh1 T A 6: 29,205,088 D261V probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jcad A G 18: 4,649,293 T55A probably benign Het
Jup G A 11: 100,374,137 R663* probably null Het
Kalrn C T 16: 34,294,215 G556D probably damaging Het
Krt81 T C 15: 101,460,139 E411G probably damaging Het
Lcat T C 8: 105,939,888 E334G probably damaging Het
Lhcgr T C 17: 88,750,157 E302G probably benign Het
Magi1 A G 6: 93,699,639 V913A possibly damaging Het
Mrpl19 A T 6: 81,964,079 probably null Het
Muc4 G T 16: 32,755,933 probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a G A 2: 22,396,243 V600I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Ngef A G 1: 87,503,264 probably null Het
Nisch A T 14: 31,176,432 probably benign Het
Nlrp4c G A 7: 6,066,956 probably null Het
Nup153 A T 13: 46,713,747 S154T probably damaging Het
Obscn A G 11: 58,994,832 probably benign Het
Olfr1247 G T 2: 89,609,349 P251H probably damaging Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr818 T C 10: 129,945,337 M242V possibly damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Phf24 G T 4: 42,934,661 C136F probably damaging Het
Phldb2 A T 16: 45,826,011 V65E probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prl8a8 A T 13: 27,508,450 M186K probably damaging Het
Qars T C 9: 108,514,610 V70A probably damaging Het
Rac1 C T 5: 143,517,225 V14I probably benign Het
Rapgef5 T A 12: 117,688,684 probably null Het
Slc16a12 G A 19: 34,670,878 T405M possibly damaging Het
Slc17a6 A G 7: 51,661,546 Y336C probably damaging Het
Slc30a9 T C 5: 67,348,052 L441P probably damaging Het
Slc45a2 T C 15: 11,022,086 S305P probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Sp1 T G 15: 102,431,003 S773A possibly damaging Het
Spen C A 4: 141,472,785 G2821C probably damaging Het
Tagap1 A G 17: 6,956,026 S424P probably benign Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tfec C T 6: 16,840,468 probably null Het
Thsd7a A T 6: 12,409,042 probably null Het
Tnfsf15 C A 4: 63,733,351 G112V probably benign Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tnxb C T 17: 34,692,333 R1537* probably null Het
Tpra1 A G 6: 88,911,823 N329S probably benign Het
Ttc12 A G 9: 49,456,884 F281S probably damaging Het
Unc79 A G 12: 103,059,320 N322S probably damaging Het
Unk G T 11: 116,030,442 probably benign Het
Usp4 G T 9: 108,348,008 G31W probably damaging Het
Vcan G T 13: 89,705,212 A543D possibly damaging Het
Vil1 A C 1: 74,418,447 I80L probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Vpreb1 A G 16: 16,869,071 probably null Het
Zbtb6 C T 2: 37,429,817 C33Y probably damaging Het
Zfp330 A T 8: 82,766,015 C189* probably null Het
Zfp942 T A 17: 21,928,541 H369L probably damaging Het
Zfp943 T A 17: 21,992,380 I149K probably benign Het
Zfyve19 G A 2: 119,211,535 V162M probably benign Het
Other mutations in Abl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Abl1 APN 2 31790812 missense probably damaging 1.00
IGL01453:Abl1 APN 2 31778977 missense probably damaging 0.99
IGL02079:Abl1 APN 2 31689948 splice site probably benign
IGL02179:Abl1 APN 2 31792249 missense probably damaging 1.00
IGL02424:Abl1 APN 2 31801132 missense probably benign
IGL02824:Abl1 APN 2 31800819 missense probably damaging 1.00
Hourglass UTSW 2 31794574 missense probably damaging 1.00
sands UTSW 2 31779010 missense probably damaging 1.00
R0733:Abl1 UTSW 2 31778945 missense probably damaging 1.00
R1222:Abl1 UTSW 2 31800994 missense probably benign
R1428:Abl1 UTSW 2 31801810 missense probably damaging 0.99
R1582:Abl1 UTSW 2 31800359 missense probably damaging 1.00
R1596:Abl1 UTSW 2 31790338 missense probably damaging 0.99
R2240:Abl1 UTSW 2 31800505 missense probably benign 0.17
R2251:Abl1 UTSW 2 31779119 missense probably damaging 1.00
R2405:Abl1 UTSW 2 31800974 missense possibly damaging 0.50
R2893:Abl1 UTSW 2 31797612 missense probably benign 0.22
R3952:Abl1 UTSW 2 31784537 missense probably damaging 1.00
R4119:Abl1 UTSW 2 31801727 missense probably damaging 1.00
R4210:Abl1 UTSW 2 31801696 missense probably damaging 0.98
R4809:Abl1 UTSW 2 31800242 missense probably damaging 1.00
R4854:Abl1 UTSW 2 31779010 missense probably damaging 1.00
R5345:Abl1 UTSW 2 31797047 missense probably damaging 0.97
R5518:Abl1 UTSW 2 31790742 missense probably damaging 1.00
R5551:Abl1 UTSW 2 31801670 missense probably benign 0.03
R5568:Abl1 UTSW 2 31779074 missense probably damaging 1.00
R5627:Abl1 UTSW 2 31800583 missense probably benign 0.00
R6435:Abl1 UTSW 2 31801549 missense possibly damaging 0.93
R6492:Abl1 UTSW 2 31801655 missense probably benign 0.38
R6738:Abl1 UTSW 2 31794574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAACTCTGCAATGGACC -3'
(R):5'- TTTTGGCCACCTGCTCAGAC -3'

Sequencing Primer
(F):5'- TGGACCACCAGCTCTCAC -3'
(R):5'- AGACCTGCTCTCACTGGTG -3'
Posted On2014-06-23