Incidental Mutation 'R0114:Gnptab'
ID20664
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene NameN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
SynonymsEG432486
MMRRC Submission 038400-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R0114 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location88379132-88447329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88433400 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 655 (P655Q)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020251
AA Change: P655Q

PolyPhen 2 Score 0.477 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: P655Q

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155306
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,985,982 probably benign Het
4933427D14Rik T C 11: 72,195,799 Y262C probably damaging Het
Adamts1 C A 16: 85,799,614 V379L probably benign Het
Akt3 T C 1: 177,067,251 D260G probably damaging Het
Alms1 T C 6: 85,619,803 L537P probably benign Het
Anln A T 9: 22,353,346 I876N probably damaging Het
Ano9 A T 7: 141,103,239 probably benign Het
Arhgef10l T C 4: 140,583,883 E218G probably benign Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atp9a G T 2: 168,710,856 Y63* probably null Het
Bmpr2 G T 1: 59,815,340 C116F probably damaging Het
Cand1 T C 10: 119,216,522 D233G probably benign Het
Cftr A T 6: 18,282,448 H1049L probably damaging Het
Ckap5 A T 2: 91,620,112 D1975V possibly damaging Het
Cyp26c1 T C 19: 37,686,633 V134A probably benign Het
Dnaic1 T C 4: 41,605,686 probably benign Het
Dpp10 T C 1: 123,486,092 I163V probably benign Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Fanca A T 8: 123,288,491 probably null Het
Fes A G 7: 80,378,035 V787A probably damaging Het
Fnip1 C T 11: 54,487,801 probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gm1840 A G 8: 5,640,359 noncoding transcript Het
Gmds A T 13: 32,227,281 S57T probably benign Het
Gnpat T G 8: 124,883,357 D426E probably benign Het
Herc1 T A 9: 66,461,846 F2941I probably damaging Het
Herc2 T C 7: 56,153,774 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Itga11 T G 9: 62,735,293 V166G probably damaging Het
Itga11 T C 9: 62,760,302 V639A possibly damaging Het
Itpr2 A G 6: 146,312,879 F1490S probably damaging Het
Lama2 C A 10: 26,993,068 E802* probably null Het
Lgi3 C T 14: 70,531,029 probably benign Het
Limch1 C T 5: 67,036,084 probably benign Het
Lipc T C 9: 70,803,781 N363S probably damaging Het
Lrit2 A G 14: 37,068,045 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug2 A G 6: 122,040,648 Y448C probably damaging Het
Mybpc3 A G 2: 91,124,494 E450G probably damaging Het
Myo5b A T 18: 74,742,171 T1549S probably benign Het
Naa15 T C 3: 51,448,438 probably null Het
Nckap1l T A 15: 103,455,028 C54S probably benign Het
Nlrp9b A G 7: 20,024,056 D406G probably benign Het
Nprl3 T A 11: 32,239,784 probably benign Het
Nvl A G 1: 181,120,391 V429A probably benign Het
Olfr114 A T 17: 37,589,415 *313K probably null Het
Olfr54 G A 11: 51,027,604 V201I probably benign Het
Olfr548-ps1 A T 7: 102,542,731 Q265L probably benign Het
Olfr801 T A 10: 129,669,598 Y307F probably benign Het
Opa1 A T 16: 29,629,635 N912Y probably benign Het
Pcnx T C 12: 81,996,095 V2317A possibly damaging Het
Phf3 A T 1: 30,805,443 N1478K possibly damaging Het
Phykpl G A 11: 51,586,653 D91N probably benign Het
Polr2b T A 5: 77,343,263 C984S probably damaging Het
Ppfibp1 A G 6: 146,998,233 R141G probably benign Het
Ppm1d G A 11: 85,326,905 G20R probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppp2r5b C A 19: 6,228,431 V483F probably benign Het
Ppp4r4 T A 12: 103,576,374 C132S probably benign Het
Prg2 A G 2: 84,983,456 probably benign Het
Prpf4b G A 13: 34,890,488 probably benign Het
Rad54l2 T C 9: 106,713,455 T491A probably damaging Het
Rnf213 G T 11: 119,414,587 W548L probably damaging Het
Rusc2 G T 4: 43,422,055 C825F probably damaging Het
Sema4b A G 7: 80,219,078 probably benign Het
Sema6a A G 18: 47,290,177 V254A probably damaging Het
Slc13a3 A G 2: 165,424,581 F346L probably damaging Het
Slc25a17 T C 15: 81,337,959 D104G probably damaging Het
Specc1 A T 11: 62,146,313 N707Y possibly damaging Het
Tex48 T A 4: 63,608,459 E76V probably damaging Het
Tfr2 T C 5: 137,577,465 V281A probably benign Het
Tgfb1i1 A C 7: 128,249,494 Q238H probably damaging Het
Thoc6 G A 17: 23,670,239 T122I probably benign Het
Tmtc1 G A 6: 148,412,830 probably benign Het
Tnfrsf8 T C 4: 145,288,047 D264G possibly damaging Het
Trim43a T A 9: 88,584,160 I178N probably damaging Het
Ttn G C 2: 76,707,093 I26503M possibly damaging Het
Usp28 C A 9: 49,039,023 D589E probably benign Het
Utp23 T C 15: 51,882,511 S242P probably damaging Het
Vwa3a A G 7: 120,775,380 Y305C probably benign Het
Vwa5b1 C A 4: 138,608,858 E142* probably null Het
Xrn2 A T 2: 147,029,779 T374S probably damaging Het
Zfp735 A T 11: 73,710,662 Q144L probably benign Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88436525 missense probably damaging 1.00
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88440305 nonsense probably null
R2118:Gnptab UTSW 10 88436398 missense probably benign 0.13
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4434:Gnptab UTSW 10 88412622 missense probably damaging 1.00
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4776:Gnptab UTSW 10 88436528 missense probably damaging 1.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4880:Gnptab UTSW 10 88432551 nonsense probably null
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6027:Gnptab UTSW 10 88433225 missense probably damaging 0.98
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6119:Gnptab UTSW 10 88431395 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACAGTGGGATGAACGCAAC -3'
(R):5'- AAGACCTTAGCAGGGCTGACTTGG -3'

Sequencing Primer
(F):5'- TGAACGCAACCACGATCTATTTTAAC -3'
(R):5'- GTTGCAAATCCAAGTTGCTCAG -3'
Posted On2013-04-11