Incidental Mutation 'R0114:Olfr801'
ID20666
Institutional Source Beutler Lab
Gene Symbol Olfr801
Ensembl Gene ENSMUSG00000058513
Gene Nameolfactory receptor 801
SynonymsGA_x6K02T2PULF-11349138-11348182, MOR110-10
MMRRC Submission 038400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R0114 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location129666989-129673865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129669598 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 307 (Y307F)
Ref Sequence ENSEMBL: ENSMUSP00000149555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072063] [ENSMUST00000203424] [ENSMUST00000213294] [ENSMUST00000216067]
Predicted Effect probably benign
Transcript: ENSMUST00000072063
AA Change: Y307F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071941
Gene: ENSMUSG00000058513
AA Change: Y307F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.2e-51 PFAM
Pfam:7tm_1 39 288 8.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203321
Predicted Effect probably benign
Transcript: ENSMUST00000203424
SMART Domains Protein: ENSMUSP00000145011
Gene: ENSMUSG00000058513

DomainStartEndE-ValueType
Pfam:7tm_4 1 96 5.9e-18 PFAM
Pfam:7tm_1 2 96 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213294
AA Change: Y307F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216067
AA Change: Y307F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1104 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,985,982 probably benign Het
4933427D14Rik T C 11: 72,195,799 Y262C probably damaging Het
Adamts1 C A 16: 85,799,614 V379L probably benign Het
Akt3 T C 1: 177,067,251 D260G probably damaging Het
Alms1 T C 6: 85,619,803 L537P probably benign Het
Anln A T 9: 22,353,346 I876N probably damaging Het
Ano9 A T 7: 141,103,239 probably benign Het
Arhgef10l T C 4: 140,583,883 E218G probably benign Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atp9a G T 2: 168,710,856 Y63* probably null Het
Bmpr2 G T 1: 59,815,340 C116F probably damaging Het
Cand1 T C 10: 119,216,522 D233G probably benign Het
Cftr A T 6: 18,282,448 H1049L probably damaging Het
Ckap5 A T 2: 91,620,112 D1975V possibly damaging Het
Cyp26c1 T C 19: 37,686,633 V134A probably benign Het
Dnaic1 T C 4: 41,605,686 probably benign Het
Dpp10 T C 1: 123,486,092 I163V probably benign Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Fanca A T 8: 123,288,491 probably null Het
Fes A G 7: 80,378,035 V787A probably damaging Het
Fnip1 C T 11: 54,487,801 probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gm1840 A G 8: 5,640,359 noncoding transcript Het
Gmds A T 13: 32,227,281 S57T probably benign Het
Gnpat T G 8: 124,883,357 D426E probably benign Het
Gnptab C A 10: 88,433,400 P655Q possibly damaging Het
Herc1 T A 9: 66,461,846 F2941I probably damaging Het
Herc2 T C 7: 56,153,774 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Itga11 T G 9: 62,735,293 V166G probably damaging Het
Itga11 T C 9: 62,760,302 V639A possibly damaging Het
Itpr2 A G 6: 146,312,879 F1490S probably damaging Het
Lama2 C A 10: 26,993,068 E802* probably null Het
Lgi3 C T 14: 70,531,029 probably benign Het
Limch1 C T 5: 67,036,084 probably benign Het
Lipc T C 9: 70,803,781 N363S probably damaging Het
Lrit2 A G 14: 37,068,045 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug2 A G 6: 122,040,648 Y448C probably damaging Het
Mybpc3 A G 2: 91,124,494 E450G probably damaging Het
Myo5b A T 18: 74,742,171 T1549S probably benign Het
Naa15 T C 3: 51,448,438 probably null Het
Nckap1l T A 15: 103,455,028 C54S probably benign Het
Nlrp9b A G 7: 20,024,056 D406G probably benign Het
Nprl3 T A 11: 32,239,784 probably benign Het
Nvl A G 1: 181,120,391 V429A probably benign Het
Olfr114 A T 17: 37,589,415 *313K probably null Het
Olfr54 G A 11: 51,027,604 V201I probably benign Het
Olfr548-ps1 A T 7: 102,542,731 Q265L probably benign Het
Opa1 A T 16: 29,629,635 N912Y probably benign Het
Pcnx T C 12: 81,996,095 V2317A possibly damaging Het
Phf3 A T 1: 30,805,443 N1478K possibly damaging Het
Phykpl G A 11: 51,586,653 D91N probably benign Het
Polr2b T A 5: 77,343,263 C984S probably damaging Het
Ppfibp1 A G 6: 146,998,233 R141G probably benign Het
Ppm1d G A 11: 85,326,905 G20R probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppp2r5b C A 19: 6,228,431 V483F probably benign Het
Ppp4r4 T A 12: 103,576,374 C132S probably benign Het
Prg2 A G 2: 84,983,456 probably benign Het
Prpf4b G A 13: 34,890,488 probably benign Het
Rad54l2 T C 9: 106,713,455 T491A probably damaging Het
Rnf213 G T 11: 119,414,587 W548L probably damaging Het
Rusc2 G T 4: 43,422,055 C825F probably damaging Het
Sema4b A G 7: 80,219,078 probably benign Het
Sema6a A G 18: 47,290,177 V254A probably damaging Het
Slc13a3 A G 2: 165,424,581 F346L probably damaging Het
Slc25a17 T C 15: 81,337,959 D104G probably damaging Het
Specc1 A T 11: 62,146,313 N707Y possibly damaging Het
Tex48 T A 4: 63,608,459 E76V probably damaging Het
Tfr2 T C 5: 137,577,465 V281A probably benign Het
Tgfb1i1 A C 7: 128,249,494 Q238H probably damaging Het
Thoc6 G A 17: 23,670,239 T122I probably benign Het
Tmtc1 G A 6: 148,412,830 probably benign Het
Tnfrsf8 T C 4: 145,288,047 D264G possibly damaging Het
Trim43a T A 9: 88,584,160 I178N probably damaging Het
Ttn G C 2: 76,707,093 I26503M possibly damaging Het
Usp28 C A 9: 49,039,023 D589E probably benign Het
Utp23 T C 15: 51,882,511 S242P probably damaging Het
Vwa3a A G 7: 120,775,380 Y305C probably benign Het
Vwa5b1 C A 4: 138,608,858 E142* probably null Het
Xrn2 A T 2: 147,029,779 T374S probably damaging Het
Zfp735 A T 11: 73,710,662 Q144L probably benign Het
Other mutations in Olfr801
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Olfr801 APN 10 129669887 missense probably damaging 1.00
IGL02400:Olfr801 APN 10 129669883 missense probably damaging 0.99
IGL02721:Olfr801 APN 10 129670123 missense probably benign 0.08
IGL03107:Olfr801 APN 10 129669940 missense probably benign 0.00
R0140:Olfr801 UTSW 10 129669688 missense probably damaging 1.00
R0652:Olfr801 UTSW 10 129670379 missense probably benign 0.08
R1375:Olfr801 UTSW 10 129670372 missense probably null 0.97
R1449:Olfr801 UTSW 10 129670369 missense probably damaging 0.99
R2026:Olfr801 UTSW 10 129670465 missense probably damaging 1.00
R2241:Olfr801 UTSW 10 129669895 missense probably damaging 1.00
R2516:Olfr801 UTSW 10 129670286 missense probably damaging 1.00
R2869:Olfr801 UTSW 10 129669759 nonsense probably null
R2869:Olfr801 UTSW 10 129669759 nonsense probably null
R2870:Olfr801 UTSW 10 129669759 nonsense probably null
R2870:Olfr801 UTSW 10 129669759 nonsense probably null
R2873:Olfr801 UTSW 10 129669759 nonsense probably null
R6562:Olfr801 UTSW 10 129670139 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAACCAACTATAGCATGAGAGACCT -3'
(R):5'- ACAATAGACCACTTCCTGTGTGACACTT -3'

Sequencing Primer
(F):5'- CCAGAAGAGATAATCCTCTCAATGTG -3'
(R):5'- TGTCATAGCTCTCATGACACTTG -3'
Posted On2013-04-11