Incidental Mutation 'R1824:Acd'
ID206680
Institutional Source Beutler Lab
Gene Symbol Acd
Ensembl Gene ENSMUSG00000038000
Gene Nameadrenocortical dysplasia
Synonyms
MMRRC Submission 039852-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R1824 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105695860-105701102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105700490 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 96 (L96P)
Ref Sequence ENSEMBL: ENSMUSP00000148285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013299] [ENSMUST00000042608] [ENSMUST00000062574] [ENSMUST00000093195] [ENSMUST00000098444] [ENSMUST00000211870] [ENSMUST00000211888] [ENSMUST00000212061] [ENSMUST00000212352] [ENSMUST00000212430] [ENSMUST00000212642] [ENSMUST00000212650] [ENSMUST00000213019]
Predicted Effect probably benign
Transcript: ENSMUST00000013299
SMART Domains Protein: ENSMUSP00000013299
Gene: ENSMUSG00000013155

DomainStartEndE-ValueType
low complexity region 220 236 N/A INTRINSIC
Pfam:Enkurin 243 339 6.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042608
AA Change: L96P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000
AA Change: L96P

DomainStartEndE-ValueType
Pfam:TPP1 11 118 2.4e-23 PFAM
low complexity region 259 272 N/A INTRINSIC
low complexity region 296 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062574
SMART Domains Protein: ENSMUSP00000052322
Gene: ENSMUSG00000050357

DomainStartEndE-ValueType
Pfam:CARMIL_C 149 442 3.3e-62 PFAM
low complexity region 467 484 N/A INTRINSIC
low complexity region 631 659 N/A INTRINSIC
low complexity region 696 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093195
SMART Domains Protein: ENSMUSP00000090886
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 15 95 2.81e-15 SMART
PDZ 167 250 1.38e-12 SMART
low complexity region 263 286 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098444
SMART Domains Protein: ENSMUSP00000096043
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 4 79 1.28e-9 SMART
PDZ 151 234 1.38e-12 SMART
low complexity region 247 270 N/A INTRINSIC
low complexity region 293 307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211870
AA Change: L96P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211888
Predicted Effect probably benign
Transcript: ENSMUST00000212061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212162
Predicted Effect probably benign
Transcript: ENSMUST00000212352
Predicted Effect probably benign
Transcript: ENSMUST00000212430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212634
Predicted Effect probably benign
Transcript: ENSMUST00000212642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212643
Predicted Effect silent
Transcript: ENSMUST00000212650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212972
Predicted Effect probably benign
Transcript: ENSMUST00000213019
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in telomere function. This protein is one of six core proteins in the telosome/shelterin telomeric complex, which functions to maintain telomere length and to protect telomere ends. Through its interaction with other components, this protein plays a key role in the assembly and stabilization of this complex, and it mediates the access of telomerase to the telomere. Multiple transcript variants encoding different isoforms have been found for this gene. This gene, which is also referred to as TPP1, is distinct from the unrelated TPP1 gene on chromosome 11, which encodes tripeptidyl-peptidase I. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce skeletal, coat, vibrissae and skin pigmentation defects. Kidney and adrenal abnormalities cause a shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,872,256 noncoding transcript Het
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abl1 T A 2: 31,800,644 M706K probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Arsi T A 18: 60,912,297 W20R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asic3 C T 5: 24,413,751 Q14* probably null Het
Asxl3 T A 18: 22,522,068 I1045N probably damaging Het
Atr T C 9: 95,936,421 I2149T probably damaging Het
Begain A G 12: 109,033,099 probably null Het
Brca2 C T 5: 150,536,922 T554I possibly damaging Het
C130079G13Rik C A 3: 59,932,580 Y24* probably null Het
C1s2 C T 6: 124,635,682 V11I probably benign Het
Cacna1i T C 15: 80,376,789 F1333L possibly damaging Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cep164 C T 9: 45,778,928 V1367M probably damaging Het
Cfap46 C A 7: 139,639,602 A1316S probably benign Het
Cic T C 7: 25,288,266 S553P probably damaging Het
Clcn2 C T 16: 20,715,962 A12T probably benign Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Coil A G 11: 88,982,097 N428S possibly damaging Het
Cpxm1 A C 2: 130,395,697 V196G probably damaging Het
Cr2 A G 1: 195,157,316 V601A probably damaging Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Dclre1a T C 19: 56,546,718 probably null Het
Dennd4a G C 9: 64,859,358 probably null Het
Dlg5 T C 14: 24,149,444 H1464R probably benign Het
Dmac2 T G 7: 25,624,792 M225R probably damaging Het
Dnah8 T C 17: 30,731,180 V1991A possibly damaging Het
Dscam A C 16: 96,825,581 V376G probably benign Het
Dync1li1 A G 9: 114,709,184 D203G probably benign Het
Eva1c A G 16: 90,866,443 T22A probably benign Het
Fam110b A G 4: 5,799,029 D149G probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Fsip1 T C 2: 118,232,908 D360G probably damaging Het
Galnt14 T C 17: 73,709,939 T41A probably benign Het
Gdf3 T A 6: 122,609,962 Q2L probably benign Het
Glrp1 A G 1: 88,509,789 probably null Het
Gm3336 C G 8: 70,720,417 probably null Het
Gm8674 C T 13: 49,900,808 noncoding transcript Het
Gnat1 A G 9: 107,676,575 Y226H probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H1foo A G 6: 115,948,758 Y1C probably null Het
Ick T A 9: 78,157,862 D351E probably benign Het
Igfbpl1 C A 4: 45,826,406 A130S probably benign Het
Impdh1 T A 6: 29,205,088 D261V probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jcad A G 18: 4,649,293 T55A probably benign Het
Jup G A 11: 100,374,137 R663* probably null Het
Kalrn C T 16: 34,294,215 G556D probably damaging Het
Krt81 T C 15: 101,460,139 E411G probably damaging Het
Lcat T C 8: 105,939,888 E334G probably damaging Het
Lhcgr T C 17: 88,750,157 E302G probably benign Het
Magi1 A G 6: 93,699,639 V913A possibly damaging Het
Mrpl19 A T 6: 81,964,079 probably null Het
Muc4 G T 16: 32,755,933 probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a G A 2: 22,396,243 V600I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Ngef A G 1: 87,503,264 probably null Het
Nisch A T 14: 31,176,432 probably benign Het
Nlrp4c G A 7: 6,066,956 probably null Het
Nup153 A T 13: 46,713,747 S154T probably damaging Het
Obscn A G 11: 58,994,832 probably benign Het
Olfr1247 G T 2: 89,609,349 P251H probably damaging Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr818 T C 10: 129,945,337 M242V possibly damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Phf24 G T 4: 42,934,661 C136F probably damaging Het
Phldb2 A T 16: 45,826,011 V65E probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prl8a8 A T 13: 27,508,450 M186K probably damaging Het
Qars T C 9: 108,514,610 V70A probably damaging Het
Rac1 C T 5: 143,517,225 V14I probably benign Het
Rapgef5 T A 12: 117,688,684 probably null Het
Slc16a12 G A 19: 34,670,878 T405M possibly damaging Het
Slc17a6 A G 7: 51,661,546 Y336C probably damaging Het
Slc30a9 T C 5: 67,348,052 L441P probably damaging Het
Slc45a2 T C 15: 11,022,086 S305P probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Sp1 T G 15: 102,431,003 S773A possibly damaging Het
Spen C A 4: 141,472,785 G2821C probably damaging Het
Tagap1 A G 17: 6,956,026 S424P probably benign Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tfec C T 6: 16,840,468 probably null Het
Thsd7a A T 6: 12,409,042 probably null Het
Tnfsf15 C A 4: 63,733,351 G112V probably benign Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tnxb C T 17: 34,692,333 R1537* probably null Het
Tpra1 A G 6: 88,911,823 N329S probably benign Het
Ttc12 A G 9: 49,456,884 F281S probably damaging Het
Unc79 A G 12: 103,059,320 N322S probably damaging Het
Unk G T 11: 116,030,442 probably benign Het
Usp4 G T 9: 108,348,008 G31W probably damaging Het
Vcan G T 13: 89,705,212 A543D possibly damaging Het
Vil1 A C 1: 74,418,447 I80L probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Vpreb1 A G 16: 16,869,071 probably null Het
Zbtb6 C T 2: 37,429,817 C33Y probably damaging Het
Zfp330 A T 8: 82,766,015 C189* probably null Het
Zfp942 T A 17: 21,928,541 H369L probably damaging Het
Zfp943 T A 17: 21,992,380 I149K probably benign Het
Zfyve19 G A 2: 119,211,535 V162M probably benign Het
Other mutations in Acd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Acd APN 8 105698454 missense probably damaging 1.00
IGL02322:Acd APN 8 105698636 missense probably benign 0.04
R0613:Acd UTSW 8 105700568 intron probably null
R1750:Acd UTSW 8 105698892 missense possibly damaging 0.93
R1870:Acd UTSW 8 105698407 critical splice donor site probably null
R2888:Acd UTSW 8 105698838 missense probably benign 0.08
R2945:Acd UTSW 8 105700295 nonsense probably null
R3001:Acd UTSW 8 105700281 critical splice donor site probably null
R3002:Acd UTSW 8 105700281 critical splice donor site probably null
R3003:Acd UTSW 8 105700281 critical splice donor site probably null
R4795:Acd UTSW 8 105701015 missense possibly damaging 0.92
R4806:Acd UTSW 8 105698290 missense possibly damaging 0.75
R6111:Acd UTSW 8 105698287 missense probably benign 0.04
R6236:Acd UTSW 8 105700495 missense probably benign 0.01
R7096:Acd UTSW 8 105698489 missense not run
Predicted Primers PCR Primer
(F):5'- GGCAGCAGGTTAAAGCGATC -3'
(R):5'- ACACCTCCGACTGGTAAGAG -3'

Sequencing Primer
(F):5'- CAGGTTAAAGCGATCCACCTGG -3'
(R):5'- AGAAGTGCTACTTGTCAGCG -3'
Posted On2014-06-23