Incidental Mutation 'R1824:Vcan'
ID206705
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Nameversican
SynonymsPG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
MMRRC Submission 039852-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1824 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location89655312-89742509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89705212 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 543 (A543D)
Ref Sequence ENSEMBL: ENSMUSP00000105171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109544
AA Change: A543D

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614
AA Change: A543D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109546
AA Change: A543D

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: A543D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,872,256 noncoding transcript Het
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abl1 T A 2: 31,800,644 M706K probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Acd A G 8: 105,700,490 L96P probably damaging Het
Arsi T A 18: 60,912,297 W20R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asic3 C T 5: 24,413,751 Q14* probably null Het
Asxl3 T A 18: 22,522,068 I1045N probably damaging Het
Atr T C 9: 95,936,421 I2149T probably damaging Het
Begain A G 12: 109,033,099 probably null Het
Brca2 C T 5: 150,536,922 T554I possibly damaging Het
C130079G13Rik C A 3: 59,932,580 Y24* probably null Het
C1s2 C T 6: 124,635,682 V11I probably benign Het
Cacna1i T C 15: 80,376,789 F1333L possibly damaging Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cep164 C T 9: 45,778,928 V1367M probably damaging Het
Cfap46 C A 7: 139,639,602 A1316S probably benign Het
Cic T C 7: 25,288,266 S553P probably damaging Het
Clcn2 C T 16: 20,715,962 A12T probably benign Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Coil A G 11: 88,982,097 N428S possibly damaging Het
Cpxm1 A C 2: 130,395,697 V196G probably damaging Het
Cr2 A G 1: 195,157,316 V601A probably damaging Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Dclre1a T C 19: 56,546,718 probably null Het
Dennd4a G C 9: 64,859,358 probably null Het
Dlg5 T C 14: 24,149,444 H1464R probably benign Het
Dmac2 T G 7: 25,624,792 M225R probably damaging Het
Dnah8 T C 17: 30,731,180 V1991A possibly damaging Het
Dscam A C 16: 96,825,581 V376G probably benign Het
Dync1li1 A G 9: 114,709,184 D203G probably benign Het
Eva1c A G 16: 90,866,443 T22A probably benign Het
Fam110b A G 4: 5,799,029 D149G probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Fsip1 T C 2: 118,232,908 D360G probably damaging Het
Galnt14 T C 17: 73,709,939 T41A probably benign Het
Gdf3 T A 6: 122,609,962 Q2L probably benign Het
Glrp1 A G 1: 88,509,789 probably null Het
Gm3336 C G 8: 70,720,417 probably null Het
Gm8674 C T 13: 49,900,808 noncoding transcript Het
Gnat1 A G 9: 107,676,575 Y226H probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H1foo A G 6: 115,948,758 Y1C probably null Het
Ick T A 9: 78,157,862 D351E probably benign Het
Igfbpl1 C A 4: 45,826,406 A130S probably benign Het
Impdh1 T A 6: 29,205,088 D261V probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jcad A G 18: 4,649,293 T55A probably benign Het
Jup G A 11: 100,374,137 R663* probably null Het
Kalrn C T 16: 34,294,215 G556D probably damaging Het
Krt81 T C 15: 101,460,139 E411G probably damaging Het
Lcat T C 8: 105,939,888 E334G probably damaging Het
Lhcgr T C 17: 88,750,157 E302G probably benign Het
Magi1 A G 6: 93,699,639 V913A possibly damaging Het
Mrpl19 A T 6: 81,964,079 probably null Het
Muc4 G T 16: 32,755,933 probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a G A 2: 22,396,243 V600I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Ngef A G 1: 87,503,264 probably null Het
Nisch A T 14: 31,176,432 probably benign Het
Nlrp4c G A 7: 6,066,956 probably null Het
Nup153 A T 13: 46,713,747 S154T probably damaging Het
Obscn A G 11: 58,994,832 probably benign Het
Olfr1247 G T 2: 89,609,349 P251H probably damaging Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr818 T C 10: 129,945,337 M242V possibly damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Phf24 G T 4: 42,934,661 C136F probably damaging Het
Phldb2 A T 16: 45,826,011 V65E probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prl8a8 A T 13: 27,508,450 M186K probably damaging Het
Qars T C 9: 108,514,610 V70A probably damaging Het
Rac1 C T 5: 143,517,225 V14I probably benign Het
Rapgef5 T A 12: 117,688,684 probably null Het
Slc16a12 G A 19: 34,670,878 T405M possibly damaging Het
Slc17a6 A G 7: 51,661,546 Y336C probably damaging Het
Slc30a9 T C 5: 67,348,052 L441P probably damaging Het
Slc45a2 T C 15: 11,022,086 S305P probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Sp1 T G 15: 102,431,003 S773A possibly damaging Het
Spen C A 4: 141,472,785 G2821C probably damaging Het
Tagap1 A G 17: 6,956,026 S424P probably benign Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tfec C T 6: 16,840,468 probably null Het
Thsd7a A T 6: 12,409,042 probably null Het
Tnfsf15 C A 4: 63,733,351 G112V probably benign Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tnxb C T 17: 34,692,333 R1537* probably null Het
Tpra1 A G 6: 88,911,823 N329S probably benign Het
Ttc12 A G 9: 49,456,884 F281S probably damaging Het
Unc79 A G 12: 103,059,320 N322S probably damaging Het
Unk G T 11: 116,030,442 probably benign Het
Usp4 G T 9: 108,348,008 G31W probably damaging Het
Vil1 A C 1: 74,418,447 I80L probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Vpreb1 A G 16: 16,869,071 probably null Het
Zbtb6 C T 2: 37,429,817 C33Y probably damaging Het
Zfp330 A T 8: 82,766,015 C189* probably null Het
Zfp942 T A 17: 21,928,541 H369L probably damaging Het
Zfp943 T A 17: 21,992,380 I149K probably benign Het
Zfyve19 G A 2: 119,211,535 V162M probably benign Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0139:Vcan UTSW 13 89691261 missense probably damaging 1.00
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1852:Vcan UTSW 13 89705392 missense probably damaging 0.99
R1868:Vcan UTSW 13 89690871 missense probably benign 0.12
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1932:Vcan UTSW 13 89705534 missense possibly damaging 0.78
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1942:Vcan UTSW 13 89703424 missense probably benign 0.01
R1964:Vcan UTSW 13 89692742 missense probably benign 0.02
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R4973:Vcan UTSW 13 89688842 missense probably benign 0.30
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTAAGTCCCCTAGCTGTGAGTAG -3'
(R):5'- ATCTCCCAACATGCTACTGGC -3'

Sequencing Primer
(F):5'- CCCCTAGCTGTGAGTAGGTAGTG -3'
(R):5'- CTGGCTCACAGGCTGTAATTACAG -3'
Posted On2014-06-23