Incidental Mutation 'R1824:Dnah8'
ID206729
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Namedynein, axonemal, heavy chain 8
SynonymsDnahc8, P1-Loop, Hst6.7b
MMRRC Submission 039852-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R1824 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location30624354-30875264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30731180 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1991 (V1991A)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170651
AA Change: V1991A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: V1991A

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,872,256 noncoding transcript Het
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abl1 T A 2: 31,800,644 M706K probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Acd A G 8: 105,700,490 L96P probably damaging Het
Arsi T A 18: 60,912,297 W20R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asic3 C T 5: 24,413,751 Q14* probably null Het
Asxl3 T A 18: 22,522,068 I1045N probably damaging Het
Atr T C 9: 95,936,421 I2149T probably damaging Het
Begain A G 12: 109,033,099 probably null Het
Brca2 C T 5: 150,536,922 T554I possibly damaging Het
C130079G13Rik C A 3: 59,932,580 Y24* probably null Het
C1s2 C T 6: 124,635,682 V11I probably benign Het
Cacna1i T C 15: 80,376,789 F1333L possibly damaging Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cep164 C T 9: 45,778,928 V1367M probably damaging Het
Cfap46 C A 7: 139,639,602 A1316S probably benign Het
Cic T C 7: 25,288,266 S553P probably damaging Het
Clcn2 C T 16: 20,715,962 A12T probably benign Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Coil A G 11: 88,982,097 N428S possibly damaging Het
Cpxm1 A C 2: 130,395,697 V196G probably damaging Het
Cr2 A G 1: 195,157,316 V601A probably damaging Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Dclre1a T C 19: 56,546,718 probably null Het
Dennd4a G C 9: 64,859,358 probably null Het
Dlg5 T C 14: 24,149,444 H1464R probably benign Het
Dmac2 T G 7: 25,624,792 M225R probably damaging Het
Dscam A C 16: 96,825,581 V376G probably benign Het
Dync1li1 A G 9: 114,709,184 D203G probably benign Het
Eva1c A G 16: 90,866,443 T22A probably benign Het
Fam110b A G 4: 5,799,029 D149G probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Fsip1 T C 2: 118,232,908 D360G probably damaging Het
Galnt14 T C 17: 73,709,939 T41A probably benign Het
Gdf3 T A 6: 122,609,962 Q2L probably benign Het
Glrp1 A G 1: 88,509,789 probably null Het
Gm3336 C G 8: 70,720,417 probably null Het
Gm8674 C T 13: 49,900,808 noncoding transcript Het
Gnat1 A G 9: 107,676,575 Y226H probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H1foo A G 6: 115,948,758 Y1C probably null Het
Ick T A 9: 78,157,862 D351E probably benign Het
Igfbpl1 C A 4: 45,826,406 A130S probably benign Het
Impdh1 T A 6: 29,205,088 D261V probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jcad A G 18: 4,649,293 T55A probably benign Het
Jup G A 11: 100,374,137 R663* probably null Het
Kalrn C T 16: 34,294,215 G556D probably damaging Het
Krt81 T C 15: 101,460,139 E411G probably damaging Het
Lcat T C 8: 105,939,888 E334G probably damaging Het
Lhcgr T C 17: 88,750,157 E302G probably benign Het
Magi1 A G 6: 93,699,639 V913A possibly damaging Het
Mrpl19 A T 6: 81,964,079 probably null Het
Muc4 G T 16: 32,755,933 probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a G A 2: 22,396,243 V600I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Ngef A G 1: 87,503,264 probably null Het
Nisch A T 14: 31,176,432 probably benign Het
Nlrp4c G A 7: 6,066,956 probably null Het
Nup153 A T 13: 46,713,747 S154T probably damaging Het
Obscn A G 11: 58,994,832 probably benign Het
Olfr1247 G T 2: 89,609,349 P251H probably damaging Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr818 T C 10: 129,945,337 M242V possibly damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Phf24 G T 4: 42,934,661 C136F probably damaging Het
Phldb2 A T 16: 45,826,011 V65E probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prl8a8 A T 13: 27,508,450 M186K probably damaging Het
Qars T C 9: 108,514,610 V70A probably damaging Het
Rac1 C T 5: 143,517,225 V14I probably benign Het
Rapgef5 T A 12: 117,688,684 probably null Het
Slc16a12 G A 19: 34,670,878 T405M possibly damaging Het
Slc17a6 A G 7: 51,661,546 Y336C probably damaging Het
Slc30a9 T C 5: 67,348,052 L441P probably damaging Het
Slc45a2 T C 15: 11,022,086 S305P probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Sp1 T G 15: 102,431,003 S773A possibly damaging Het
Spen C A 4: 141,472,785 G2821C probably damaging Het
Tagap1 A G 17: 6,956,026 S424P probably benign Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tfec C T 6: 16,840,468 probably null Het
Thsd7a A T 6: 12,409,042 probably null Het
Tnfsf15 C A 4: 63,733,351 G112V probably benign Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tnxb C T 17: 34,692,333 R1537* probably null Het
Tpra1 A G 6: 88,911,823 N329S probably benign Het
Ttc12 A G 9: 49,456,884 F281S probably damaging Het
Unc79 A G 12: 103,059,320 N322S probably damaging Het
Unk G T 11: 116,030,442 probably benign Het
Usp4 G T 9: 108,348,008 G31W probably damaging Het
Vcan G T 13: 89,705,212 A543D possibly damaging Het
Vil1 A C 1: 74,418,447 I80L probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Vpreb1 A G 16: 16,869,071 probably null Het
Zbtb6 C T 2: 37,429,817 C33Y probably damaging Het
Zfp330 A T 8: 82,766,015 C189* probably null Het
Zfp942 T A 17: 21,928,541 H369L probably damaging Het
Zfp943 T A 17: 21,992,380 I149K probably benign Het
Zfyve19 G A 2: 119,211,535 V162M probably benign Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30677176 missense probably benign 0.06
IGL00508:Dnah8 APN 17 30855930 missense probably damaging 1.00
IGL00547:Dnah8 APN 17 30815703 nonsense probably null
IGL00551:Dnah8 APN 17 30663478 nonsense probably null
IGL00732:Dnah8 APN 17 30656641 missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30767906 nonsense probably null
IGL00840:Dnah8 APN 17 30790941 missense probably damaging 1.00
IGL00845:Dnah8 APN 17 30819276 critical splice donor site probably null
IGL00953:Dnah8 APN 17 30706457 nonsense probably null
IGL00976:Dnah8 APN 17 30851710 missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30636005 missense probably benign 0.06
IGL01467:Dnah8 APN 17 30779916 missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30683714 splice site probably benign
IGL01515:Dnah8 APN 17 30648485 missense probably benign
IGL01723:Dnah8 APN 17 30708471 missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30751591 critical splice donor site probably null
IGL01921:Dnah8 APN 17 30736141 missense probably benign
IGL01958:Dnah8 APN 17 30855895 splice site probably benign
IGL01968:Dnah8 APN 17 30656598 nonsense probably null
IGL02093:Dnah8 APN 17 30717880 missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30648417 missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 30794763 missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30706513 critical splice donor site probably null
IGL02236:Dnah8 APN 17 30649773 nonsense probably null
IGL02259:Dnah8 APN 17 30759614 missense probably benign
IGL02263:Dnah8 APN 17 30729165 missense probably benign 0.00
IGL02303:Dnah8 APN 17 30713047 missense probably benign 0.03
IGL02341:Dnah8 APN 17 30747257 missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02377:Dnah8 APN 17 30794796 missense probably damaging 0.98
IGL02390:Dnah8 APN 17 30830845 missense probably benign 0.01
IGL02392:Dnah8 APN 17 30818051 splice site probably benign
IGL02414:Dnah8 APN 17 30700413 missense probably benign
IGL02455:Dnah8 APN 17 30672334 missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30668295 missense probably benign
IGL02831:Dnah8 APN 17 30712276 missense probably benign 0.23
IGL02863:Dnah8 APN 17 30769697 missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30721110 nonsense probably null
IGL02954:Dnah8 APN 17 30704835 missense probably benign 0.30
IGL02964:Dnah8 APN 17 30746761 missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30719006 missense probably benign 0.01
IGL03081:Dnah8 APN 17 30686373 splice site probably benign
IGL03086:Dnah8 APN 17 30742780 missense probably damaging 1.00
IGL03087:Dnah8 APN 17 30784144 missense probably benign
IGL03176:Dnah8 APN 17 30694037 missense probably benign
IGL03191:Dnah8 APN 17 30726830 missense probably damaging 0.99
IGL03210:Dnah8 APN 17 30815665 missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30673920 splice site probably null
IGL03255:Dnah8 APN 17 30741381 missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30672349 missense probably benign
IGL03348:Dnah8 APN 17 30746986 missense probably damaging 0.99
FR4340:Dnah8 UTSW 17 30635463 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635465 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635477 small deletion probably benign
I2288:Dnah8 UTSW 17 30663454 missense probably benign
P0029:Dnah8 UTSW 17 30765720 missense probably damaging 1.00
R0016:Dnah8 UTSW 17 30663316 missense probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30755119 missense probably damaging 1.00
R0090:Dnah8 UTSW 17 30784090 missense probably benign 0.20
R0119:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0184:Dnah8 UTSW 17 30683683 missense probably benign 0.04
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30690271 missense probably benign
R0268:Dnah8 UTSW 17 30769707 missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30736156 missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 30871351 missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30708390 missense probably benign 0.02
R0423:Dnah8 UTSW 17 30701981 missense probably benign
R0470:Dnah8 UTSW 17 30708540 splice site probably benign
R0477:Dnah8 UTSW 17 30755080 missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30700419 missense probably benign
R0499:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30718961 missense probably benign 0.01
R0601:Dnah8 UTSW 17 30708358 missense probably benign 0.06
R0646:Dnah8 UTSW 17 30684173 missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30736155 missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30704662 missense probably benign
R0843:Dnah8 UTSW 17 30813095 missense probably damaging 1.00
R0940:Dnah8 UTSW 17 30803243 missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30673920 splice site probably null
R1102:Dnah8 UTSW 17 30854764 intron probably null
R1137:Dnah8 UTSW 17 30855936 missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30721000 missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30737295 missense probably damaging 1.00
R1377:Dnah8 UTSW 17 30840622 nonsense probably null
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1497:Dnah8 UTSW 17 30752075 missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30673888 missense probably benign
R1541:Dnah8 UTSW 17 30747247 missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30635664 missense probably benign 0.07
R1634:Dnah8 UTSW 17 30713098 critical splice donor site probably null
R1670:Dnah8 UTSW 17 30725124 missense probably damaging 1.00
R1710:Dnah8 UTSW 17 30854940 missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30769651 missense probably benign 0.28
R1761:Dnah8 UTSW 17 30779916 missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30722937 missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30708407 missense probably benign 0.00
R1808:Dnah8 UTSW 17 30684186 missense probably damaging 1.00
R1836:Dnah8 UTSW 17 30874927 missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30635505 missense unknown
R1935:Dnah8 UTSW 17 30726896 splice site probably benign
R1940:Dnah8 UTSW 17 30731207 missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30712385 missense probably benign 0.00
R2025:Dnah8 UTSW 17 30731159 missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30758281 missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30635658 missense probably benign 0.01
R2148:Dnah8 UTSW 17 30737258 missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30653393 missense probably benign
R2180:Dnah8 UTSW 17 30840647 missense probably benign 0.00
R2262:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2328:Dnah8 UTSW 17 30794744 missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30771872 missense probably benign
R2357:Dnah8 UTSW 17 30874935 missense probably benign 0.00
R2360:Dnah8 UTSW 17 30677204 missense probably benign 0.22
R2496:Dnah8 UTSW 17 30851731 missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30741365 nonsense probably null
R2509:Dnah8 UTSW 17 30775045 missense probably benign 0.02
R3114:Dnah8 UTSW 17 30833568 missense probably benign 0.04
R3708:Dnah8 UTSW 17 30739657 missense probably damaging 0.98
R3720:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3722:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30739648 nonsense probably null
R3747:Dnah8 UTSW 17 30784174 nonsense probably null
R3748:Dnah8 UTSW 17 30784174 nonsense probably null
R3749:Dnah8 UTSW 17 30784174 nonsense probably null
R3787:Dnah8 UTSW 17 30755041 missense probably damaging 1.00
R3790:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30670647 missense probably benign 0.00
R3857:Dnah8 UTSW 17 30663422 missense probably damaging 0.96
R3898:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3899:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3938:Dnah8 UTSW 17 30854937 missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30694065 splice site probably benign
R4091:Dnah8 UTSW 17 30769839 missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30748559 missense probably benign
R4326:Dnah8 UTSW 17 30752092 missense probably benign 0.04
R4346:Dnah8 UTSW 17 30725098 missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30752146 missense probably damaging 1.00
R4457:Dnah8 UTSW 17 30813151 missense probably benign
R4475:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4565:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4566:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4568:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4573:Dnah8 UTSW 17 30700406 missense probably benign 0.00
R4580:Dnah8 UTSW 17 30662052 missense probably benign 0.00
R4585:Dnah8 UTSW 17 30751567 missense probably benign 0.01
R4611:Dnah8 UTSW 17 30684237 missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30683634 missense probably benign 0.08
R4721:Dnah8 UTSW 17 30725166 missense probably damaging 1.00
R4727:Dnah8 UTSW 17 30851747 missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4732:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4733:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4798:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4814:Dnah8 UTSW 17 30767924 missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4894:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4900:Dnah8 UTSW 17 30746975 missense probably damaging 1.00
R4901:Dnah8 UTSW 17 30840714 critical splice donor site probably null
R4913:Dnah8 UTSW 17 30819139 missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4932:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4933:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4942:Dnah8 UTSW 17 30729142 missense probably benign
R4969:Dnah8 UTSW 17 30723014 missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4977:Dnah8 UTSW 17 30663301 missense probably benign 0.00
R5001:Dnah8 UTSW 17 30787185 missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5013:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5014:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5024:Dnah8 UTSW 17 30736096 missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30739757 critical splice donor site probably null
R5075:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5075:Dnah8 UTSW 17 30800531 missense probably damaging 1.00
R5112:Dnah8 UTSW 17 30731038 missense probably benign 0.02
R5121:Dnah8 UTSW 17 30810353 missense probably benign 0.14
R5138:Dnah8 UTSW 17 30765597 missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30712295 missense probably benign 0.06
R5191:Dnah8 UTSW 17 30746765 missense probably damaging 1.00
R5238:Dnah8 UTSW 17 30790917 missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30700419 missense probably benign
R5358:Dnah8 UTSW 17 30746954 missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5404:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5482:Dnah8 UTSW 17 30800547 missense probably damaging 0.96
R5489:Dnah8 UTSW 17 30790956 missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30752916 missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30706386 missense probably benign 0.00
R5640:Dnah8 UTSW 17 30803108 missense probably damaging 1.00
R5649:Dnah8 UTSW 17 30800587 missense probably benign 0.13
R5662:Dnah8 UTSW 17 30737333 missense probably damaging 1.00
R5673:Dnah8 UTSW 17 30803261 missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5699:Dnah8 UTSW 17 30810324 missense probably benign 0.22
R5737:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5738:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5739:Dnah8 UTSW 17 30719007 missense probably benign 0.00
R5766:Dnah8 UTSW 17 30690261 missense probably benign 0.01
R5790:Dnah8 UTSW 17 30875004 missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30728191 missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 30794763 missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5886:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5887:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30656685 missense probably benign 0.32
R5979:Dnah8 UTSW 17 30815664 nonsense probably null
R5986:Dnah8 UTSW 17 30851630 missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30663305 missense probably benign 0.32
R6042:Dnah8 UTSW 17 30747265 missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6181:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6237:Dnah8 UTSW 17 30747854 nonsense probably null
R6239:Dnah8 UTSW 17 30810359 missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6365:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6416:Dnah8 UTSW 17 30765635 missense probably benign
R6443:Dnah8 UTSW 17 30771885 missense probably benign 0.10
R6478:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6479:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6480:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6481:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6533:Dnah8 UTSW 17 30746990 missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6608:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6610:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6675:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6723:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6724:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6754:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6755:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6759:Dnah8 UTSW 17 30663292 splice site probably null
R6765:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6766:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6778:Dnah8 UTSW 17 30635666 missense probably benign 0.00
R6781:Dnah8 UTSW 17 30765724 frame shift probably null
R6788:Dnah8 UTSW 17 30648465 missense probably benign 0.14
R6814:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30741173 missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30710551 missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30746959 missense probably damaging 1.00
R6944:Dnah8 UTSW 17 30794659 missense probably benign 0.09
R6982:Dnah8 UTSW 17 30767925 missense probably benign 0.03
R6984:Dnah8 UTSW 17 30739738 missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30662091 missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30643275 missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30704724 missense not run
R7106:Dnah8 UTSW 17 30741178 missense not run
R7112:Dnah8 UTSW 17 30871392 missense not run
R7146:Dnah8 UTSW 17 30644617 missense not run
R7146:Dnah8 UTSW 17 30769644 missense not run
X0001:Dnah8 UTSW 17 30748680 missense probably damaging 1.00
X0013:Dnah8 UTSW 17 30819186 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CAGACATGTGTGCCTGGTGTTC -3'
(R):5'- TGCAGGCAGGTCCATCATTC -3'

Sequencing Primer
(F):5'- ACATGTTATACAAGTGTGTCTGCTG -3'
(R):5'- GGTCCATCATTCCGAACAACATGTG -3'
Posted On2014-06-23