Incidental Mutation 'R1826:Fry'
ID206770
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 039853-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R1826 (G1)
Quality Score213
Status Validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 150436709 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1940 (S1940L)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087204
AA Change: S1940L

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: S1940L

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201634
Predicted Effect probably benign
Transcript: ENSMUST00000202566
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 95% (116/122)
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,822,014 S917P probably benign Het
Acsbg1 C T 9: 54,622,556 V256M possibly damaging Het
Adam34 T A 8: 43,651,342 D422V probably damaging Het
Adam6a T A 12: 113,546,122 V705E possibly damaging Het
Adamts12 C A 15: 11,071,520 P50Q probably benign Het
Arfgap3 C T 15: 83,303,102 probably null Het
Aspg T A 12: 112,123,418 D463E probably damaging Het
Atad2b G A 12: 4,974,094 S73N probably benign Het
Atp11a T C 8: 12,846,154 L788P probably damaging Het
B3gnt8 T C 7: 25,628,763 F206S probably damaging Het
Baz2b T C 2: 59,968,733 E349G probably benign Het
Bmp2k A T 5: 97,061,402 probably benign Het
Camta2 A G 11: 70,683,308 F128L probably damaging Het
Ccdc88a A T 11: 29,489,637 Q30L possibly damaging Het
Cdh1 T C 8: 106,666,266 M794T probably benign Het
Cdh5 A G 8: 104,131,091 N383S possibly damaging Het
Cep85l T C 10: 53,348,812 D227G possibly damaging Het
Clec4e A G 6: 123,283,632 S156P probably damaging Het
Col10a1 G T 10: 34,394,649 G206C probably damaging Het
Col4a2 T C 8: 11,313,509 probably null Het
Copg2 A G 6: 30,812,842 M517T probably benign Het
Cyp2f2 T A 7: 27,132,562 L414Q probably damaging Het
Dact1 G A 12: 71,318,344 G596D probably damaging Het
Dcaf13 T C 15: 39,118,899 C87R probably damaging Het
Dchs1 T G 7: 105,757,627 T2224P probably damaging Het
Dnah12 A G 14: 26,711,019 M429V probably benign Het
Dppa2 G A 16: 48,317,348 R231H probably damaging Het
Elavl4 T C 4: 110,251,292 D78G probably damaging Het
Enthd1 T C 15: 80,474,281 E346G probably damaging Het
Exoc3l A T 8: 105,293,618 I225N probably damaging Het
Fam208b T A 13: 3,581,759 N914I probably damaging Het
Fasn C T 11: 120,808,499 probably benign Het
Fbxl7 G A 15: 26,552,765 R139C possibly damaging Het
Fbxw15 C A 9: 109,559,714 probably null Het
Flnc A G 6: 29,455,185 T1971A probably damaging Het
Fnip1 T G 11: 54,466,164 V33G probably damaging Het
Foxn2 A G 17: 88,486,805 E390G possibly damaging Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Gabrd T C 4: 155,386,486 Y255C probably damaging Het
Garem1 A T 18: 21,129,452 F768L probably benign Het
Gas2 T A 7: 51,943,673 L167Q probably damaging Het
Gm16391 A G 17: 76,284,423 noncoding transcript Het
Gm1979 A T 5: 26,001,242 N113K probably damaging Het
Gm5751 T A X: 8,880,705 Y133* probably null Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Hdac4 T A 1: 91,984,699 N352Y probably damaging Het
Hdac9 A G 12: 34,429,492 probably benign Het
Hhipl2 G A 1: 183,436,344 S673N probably benign Het
Iffo2 T A 4: 139,614,065 S417T probably benign Het
Itgb5 G T 16: 33,865,560 R90L possibly damaging Het
Jade1 T G 3: 41,613,213 L572W probably damaging Het
Kcnh1 T A 1: 192,413,068 M478K possibly damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnq4 T A 4: 120,704,504 H456L probably benign Het
Kif9 C A 9: 110,517,633 T613K probably benign Het
Krt36 T G 11: 100,103,030 probably benign Het
Kyat3 A T 3: 142,723,179 D89V possibly damaging Het
Lnpep A T 17: 17,562,836 F568I probably damaging Het
Lpl T C 8: 68,902,291 F444L possibly damaging Het
Lrp1 A T 10: 127,553,707 V3153E probably damaging Het
Lrrn1 A T 6: 107,567,568 N109I probably benign Het
Ltn1 A G 16: 87,415,616 Y686H probably damaging Het
Mcoln2 A C 3: 146,175,472 D166A possibly damaging Het
Ms4a6b A T 19: 11,523,934 I103F probably damaging Het
Mtmr10 T G 7: 64,337,466 S585A probably benign Het
Mx1 T C 16: 97,455,637 N114S possibly damaging Het
Mysm1 A T 4: 94,970,686 N75K probably benign Het
Nkx1-1 A G 5: 33,433,933 V15A unknown Het
Nlrp1a T A 11: 71,107,980 probably benign Het
Nlrp1a G A 11: 71,122,747 T559I possibly damaging Het
Oas1f A G 5: 120,855,589 K288R probably benign Het
Olfr1494 T A 19: 13,749,347 D80E probably benign Het
Olfr311 T A 11: 58,841,431 C106S probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pcdhb5 C T 18: 37,321,469 R301* probably null Het
Phf12 T C 11: 78,024,954 probably benign Het
Pik3c2a C T 7: 116,368,117 D862N probably benign Het
Pkhd1l1 T A 15: 44,503,345 L740I possibly damaging Het
Ppp1r9a A T 6: 5,111,060 probably benign Het
Prg4 T C 1: 150,452,009 D820G probably benign Het
Prmt9 C T 8: 77,555,674 Q67* probably null Het
Prob1 T C 18: 35,653,575 E542G possibly damaging Het
Pttg1 A G 11: 43,420,366 V188A probably damaging Het
Rassf1 T A 9: 107,558,193 L260H probably damaging Het
Rbm5 T A 9: 107,742,414 Q766L probably damaging Het
Rbms3 T A 9: 116,822,868 Y137F probably damaging Het
Rccd1 T C 7: 80,320,218 probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Setd4 T A 16: 93,591,299 K100* probably null Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Slc16a1 G T 3: 104,650,939 A91S probably benign Het
Slc36a1 A G 11: 55,220,453 N133S probably benign Het
Svil C T 18: 5,063,383 P885S probably benign Het
Svop A T 5: 114,060,056 probably null Het
Taar7d T C 10: 24,027,576 Y119H probably damaging Het
Tgfb3 T C 12: 86,062,044 T304A probably benign Het
Tmem94 C A 11: 115,793,213 C786* probably null Het
Tnfrsf4 T A 4: 156,016,279 probably null Het
Tns1 C A 1: 73,953,634 M1I probably null Het
Trappc13 C T 13: 104,169,819 probably null Het
Trim72 T C 7: 128,007,844 F182L possibly damaging Het
Ttc6 T C 12: 57,660,247 S647P probably benign Het
Tulp1 A G 17: 28,356,367 L400P possibly damaging Het
Vegfc C T 8: 54,181,312 T342M possibly damaging Het
Vit T A 17: 78,534,676 V15E probably benign Het
Vps13d A T 4: 145,155,003 M1334K probably damaging Het
Zfp280d T C 9: 72,298,780 V23A probably damaging Het
Zfp608 A G 18: 54,898,576 I764T probably benign Het
Zfp94 T C 7: 24,309,115 Y33C probably damaging Het
Zfyve26 T A 12: 79,269,049 I1218F probably damaging Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGCTAAGGTTTATTTCCCATAGCC -3'
(R):5'- TTCTTGGGCACAGAGAAGC -3'

Sequencing Primer
(F):5'- TTTAAGTAGAAAGTAGATGCCCCGC -3'
(R):5'- AGAAGCTTCTCTGGTGCCG -3'
Posted On2014-06-23