Incidental Mutation 'R0114:Thoc6'
ID20681
Institutional Source Beutler Lab
Gene Symbol Thoc6
Ensembl Gene ENSMUSG00000041319
Gene NameTHO complex 6
SynonymsWdr58, F830014G06Rik
MMRRC Submission 038400-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock #R0114 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location23668614-23673882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23670239 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 122 (T122I)
Ref Sequence ENSEMBL: ENSMUSP00000111153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024697] [ENSMUST00000047436] [ENSMUST00000062967] [ENSMUST00000095579] [ENSMUST00000115489] [ENSMUST00000115490] [ENSMUST00000138190] [ENSMUST00000179928] [ENSMUST00000180140]
Predicted Effect probably benign
Transcript: ENSMUST00000024697
SMART Domains Protein: ENSMUSP00000024697
Gene: ENSMUSG00000023904

DomainStartEndE-ValueType
Pfam:HPIP 2 116 7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047436
AA Change: T122I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000038137
Gene: ENSMUSG00000041319
AA Change: T122I

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062967
SMART Domains Protein: ENSMUSP00000053808
Gene: ENSMUSG00000043782

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
coiled coil region 63 293 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
coiled coil region 354 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095579
AA Change: T122I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000093239
Gene: ENSMUSG00000041319
AA Change: T122I

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115489
AA Change: T118I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000111152
Gene: ENSMUSG00000041319
AA Change: T118I

DomainStartEndE-ValueType
Blast:WD40 11 47 6e-18 BLAST
WD40 61 97 2.67e-1 SMART
Blast:WD40 115 150 8e-12 BLAST
WD40 153 192 1.28e-6 SMART
Blast:WD40 196 241 3e-25 BLAST
WD40 244 280 7.36e1 SMART
low complexity region 290 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115490
AA Change: T122I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000111153
Gene: ENSMUSG00000041319
AA Change: T122I

DomainStartEndE-ValueType
Blast:WD40 13 51 7e-19 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 6e-12 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 8e-26 BLAST
Blast:WD40 248 279 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133849
Predicted Effect unknown
Transcript: ENSMUST00000135259
AA Change: T34I
SMART Domains Protein: ENSMUSP00000119920
Gene: ENSMUSG00000041319
AA Change: T34I

DomainStartEndE-ValueType
Blast:WD40 32 67 9e-13 BLAST
WD40 70 109 1.28e-6 SMART
Blast:WD40 113 186 4e-20 BLAST
Blast:WD40 189 209 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138190
SMART Domains Protein: ENSMUSP00000123075
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 6e-20 BLAST
WD40 65 101 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179928
SMART Domains Protein: ENSMUSP00000137205
Gene: ENSMUSG00000023904

DomainStartEndE-ValueType
Pfam:HPIP 2 112 3.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180140
SMART Domains Protein: ENSMUSP00000137336
Gene: ENSMUSG00000023904

DomainStartEndE-ValueType
Pfam:HPIP 2 116 2.9e-58 PFAM
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the multi-protein THO complex, which is involved in coordination between transcription and mRNA processing. The THO complex is a component of the TREX (transcription/export) complex, which is involved in transcription and export of mRNAs. A missense mutation in this gene is associated with a neurodevelopmental disorder called Beaulieu-Boycott-Innes syndrome. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,985,982 probably benign Het
4933427D14Rik T C 11: 72,195,799 Y262C probably damaging Het
Adamts1 C A 16: 85,799,614 V379L probably benign Het
Akt3 T C 1: 177,067,251 D260G probably damaging Het
Alms1 T C 6: 85,619,803 L537P probably benign Het
Anln A T 9: 22,353,346 I876N probably damaging Het
Ano9 A T 7: 141,103,239 probably benign Het
Arhgef10l T C 4: 140,583,883 E218G probably benign Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atp9a G T 2: 168,710,856 Y63* probably null Het
Bmpr2 G T 1: 59,815,340 C116F probably damaging Het
Cand1 T C 10: 119,216,522 D233G probably benign Het
Cftr A T 6: 18,282,448 H1049L probably damaging Het
Ckap5 A T 2: 91,620,112 D1975V possibly damaging Het
Cyp26c1 T C 19: 37,686,633 V134A probably benign Het
Dnaic1 T C 4: 41,605,686 probably benign Het
Dpp10 T C 1: 123,486,092 I163V probably benign Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Fanca A T 8: 123,288,491 probably null Het
Fes A G 7: 80,378,035 V787A probably damaging Het
Fnip1 C T 11: 54,487,801 probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gm1840 A G 8: 5,640,359 noncoding transcript Het
Gmds A T 13: 32,227,281 S57T probably benign Het
Gnpat T G 8: 124,883,357 D426E probably benign Het
Gnptab C A 10: 88,433,400 P655Q possibly damaging Het
Herc1 T A 9: 66,461,846 F2941I probably damaging Het
Herc2 T C 7: 56,153,774 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Itga11 T G 9: 62,735,293 V166G probably damaging Het
Itga11 T C 9: 62,760,302 V639A possibly damaging Het
Itpr2 A G 6: 146,312,879 F1490S probably damaging Het
Lama2 C A 10: 26,993,068 E802* probably null Het
Lgi3 C T 14: 70,531,029 probably benign Het
Limch1 C T 5: 67,036,084 probably benign Het
Lipc T C 9: 70,803,781 N363S probably damaging Het
Lrit2 A G 14: 37,068,045 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug2 A G 6: 122,040,648 Y448C probably damaging Het
Mybpc3 A G 2: 91,124,494 E450G probably damaging Het
Myo5b A T 18: 74,742,171 T1549S probably benign Het
Naa15 T C 3: 51,448,438 probably null Het
Nckap1l T A 15: 103,455,028 C54S probably benign Het
Nlrp9b A G 7: 20,024,056 D406G probably benign Het
Nprl3 T A 11: 32,239,784 probably benign Het
Nvl A G 1: 181,120,391 V429A probably benign Het
Olfr114 A T 17: 37,589,415 *313K probably null Het
Olfr54 G A 11: 51,027,604 V201I probably benign Het
Olfr548-ps1 A T 7: 102,542,731 Q265L probably benign Het
Olfr801 T A 10: 129,669,598 Y307F probably benign Het
Opa1 A T 16: 29,629,635 N912Y probably benign Het
Pcnx T C 12: 81,996,095 V2317A possibly damaging Het
Phf3 A T 1: 30,805,443 N1478K possibly damaging Het
Phykpl G A 11: 51,586,653 D91N probably benign Het
Polr2b T A 5: 77,343,263 C984S probably damaging Het
Ppfibp1 A G 6: 146,998,233 R141G probably benign Het
Ppm1d G A 11: 85,326,905 G20R probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppp2r5b C A 19: 6,228,431 V483F probably benign Het
Ppp4r4 T A 12: 103,576,374 C132S probably benign Het
Prg2 A G 2: 84,983,456 probably benign Het
Prpf4b G A 13: 34,890,488 probably benign Het
Rad54l2 T C 9: 106,713,455 T491A probably damaging Het
Rnf213 G T 11: 119,414,587 W548L probably damaging Het
Rusc2 G T 4: 43,422,055 C825F probably damaging Het
Sema4b A G 7: 80,219,078 probably benign Het
Sema6a A G 18: 47,290,177 V254A probably damaging Het
Slc13a3 A G 2: 165,424,581 F346L probably damaging Het
Slc25a17 T C 15: 81,337,959 D104G probably damaging Het
Specc1 A T 11: 62,146,313 N707Y possibly damaging Het
Tex48 T A 4: 63,608,459 E76V probably damaging Het
Tfr2 T C 5: 137,577,465 V281A probably benign Het
Tgfb1i1 A C 7: 128,249,494 Q238H probably damaging Het
Tmtc1 G A 6: 148,412,830 probably benign Het
Tnfrsf8 T C 4: 145,288,047 D264G possibly damaging Het
Trim43a T A 9: 88,584,160 I178N probably damaging Het
Ttn G C 2: 76,707,093 I26503M possibly damaging Het
Usp28 C A 9: 49,039,023 D589E probably benign Het
Utp23 T C 15: 51,882,511 S242P probably damaging Het
Vwa3a A G 7: 120,775,380 Y305C probably benign Het
Vwa5b1 C A 4: 138,608,858 E142* probably null Het
Xrn2 A T 2: 147,029,779 T374S probably damaging Het
Zfp735 A T 11: 73,710,662 Q144L probably benign Het
Other mutations in Thoc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Thoc6 APN 17 23669883 missense possibly damaging 0.68
R0100:Thoc6 UTSW 17 23669850 missense probably damaging 1.00
R0448:Thoc6 UTSW 17 23669576 missense probably damaging 1.00
R1324:Thoc6 UTSW 17 23677463 unclassified probably null
R1917:Thoc6 UTSW 17 23669390 unclassified probably benign
R2894:Thoc6 UTSW 17 23669035 missense probably damaging 0.98
R4125:Thoc6 UTSW 17 23669345 unclassified probably benign
R4765:Thoc6 UTSW 17 23670888 missense probably damaging 1.00
R4791:Thoc6 UTSW 17 23670067 missense possibly damaging 0.74
R4962:Thoc6 UTSW 17 23669937 missense probably damaging 1.00
R5527:Thoc6 UTSW 17 23670795 missense probably damaging 1.00
R5940:Thoc6 UTSW 17 23670341 missense probably benign 0.00
R5965:Thoc6 UTSW 17 23670868 missense possibly damaging 0.80
R6232:Thoc6 UTSW 17 23670321 critical splice donor site probably null
R6639:Thoc6 UTSW 17 23670454 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGGCCCCAGTTTCCAGATCCATAC -3'
(R):5'- AGCATGGTCTCCACAGATCGACAC -3'

Sequencing Primer
(F):5'- AGTTTCCAGATCCATACTGTGC -3'
(R):5'- CTTTGGGCAGAAATTCTCAAGAAG -3'
Posted On2013-04-11