Incidental Mutation 'R1826:Ltn1'
ID206846
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Namelisterin E3 ubiquitin protein ligase 1
Synonyms4930528H02Rik, Rnf160, Zfp294, Listerin
MMRRC Submission 039853-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1826 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87376651-87432612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87415616 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 686 (Y686H)
Ref Sequence ENSEMBL: ENSMUSP00000156299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]
Predicted Effect probably damaging
Transcript: ENSMUST00000039449
AA Change: Y686H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: Y686H

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083713
Predicted Effect probably damaging
Transcript: ENSMUST00000232095
AA Change: Y686H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 95% (116/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,822,014 S917P probably benign Het
Acsbg1 C T 9: 54,622,556 V256M possibly damaging Het
Adam34 T A 8: 43,651,342 D422V probably damaging Het
Adam6a T A 12: 113,546,122 V705E possibly damaging Het
Adamts12 C A 15: 11,071,520 P50Q probably benign Het
Arfgap3 C T 15: 83,303,102 probably null Het
Aspg T A 12: 112,123,418 D463E probably damaging Het
Atad2b G A 12: 4,974,094 S73N probably benign Het
Atp11a T C 8: 12,846,154 L788P probably damaging Het
B3gnt8 T C 7: 25,628,763 F206S probably damaging Het
Baz2b T C 2: 59,968,733 E349G probably benign Het
Bmp2k A T 5: 97,061,402 probably benign Het
Camta2 A G 11: 70,683,308 F128L probably damaging Het
Ccdc88a A T 11: 29,489,637 Q30L possibly damaging Het
Cdh1 T C 8: 106,666,266 M794T probably benign Het
Cdh5 A G 8: 104,131,091 N383S possibly damaging Het
Cep85l T C 10: 53,348,812 D227G possibly damaging Het
Clec4e A G 6: 123,283,632 S156P probably damaging Het
Col10a1 G T 10: 34,394,649 G206C probably damaging Het
Col4a2 T C 8: 11,313,509 probably null Het
Copg2 A G 6: 30,812,842 M517T probably benign Het
Cyp2f2 T A 7: 27,132,562 L414Q probably damaging Het
Dact1 G A 12: 71,318,344 G596D probably damaging Het
Dcaf13 T C 15: 39,118,899 C87R probably damaging Het
Dchs1 T G 7: 105,757,627 T2224P probably damaging Het
Dnah12 A G 14: 26,711,019 M429V probably benign Het
Dppa2 G A 16: 48,317,348 R231H probably damaging Het
Elavl4 T C 4: 110,251,292 D78G probably damaging Het
Enthd1 T C 15: 80,474,281 E346G probably damaging Het
Exoc3l A T 8: 105,293,618 I225N probably damaging Het
Fam208b T A 13: 3,581,759 N914I probably damaging Het
Fasn C T 11: 120,808,499 probably benign Het
Fbxl7 G A 15: 26,552,765 R139C possibly damaging Het
Fbxw15 C A 9: 109,559,714 probably null Het
Flnc A G 6: 29,455,185 T1971A probably damaging Het
Fnip1 T G 11: 54,466,164 V33G probably damaging Het
Foxn2 A G 17: 88,486,805 E390G possibly damaging Het
Fry C T 5: 150,436,709 S1940L possibly damaging Het
Fzd3 A T 14: 65,253,106 D9E probably benign Het
Gabrd T C 4: 155,386,486 Y255C probably damaging Het
Garem1 A T 18: 21,129,452 F768L probably benign Het
Gas2 T A 7: 51,943,673 L167Q probably damaging Het
Gm16391 A G 17: 76,284,423 noncoding transcript Het
Gm1979 A T 5: 26,001,242 N113K probably damaging Het
Gm5751 T A X: 8,880,705 Y133* probably null Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Hdac4 T A 1: 91,984,699 N352Y probably damaging Het
Hdac9 A G 12: 34,429,492 probably benign Het
Hhipl2 G A 1: 183,436,344 S673N probably benign Het
Iffo2 T A 4: 139,614,065 S417T probably benign Het
Itgb5 G T 16: 33,865,560 R90L possibly damaging Het
Jade1 T G 3: 41,613,213 L572W probably damaging Het
Kcnh1 T A 1: 192,413,068 M478K possibly damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnq4 T A 4: 120,704,504 H456L probably benign Het
Kif9 C A 9: 110,517,633 T613K probably benign Het
Krt36 T G 11: 100,103,030 probably benign Het
Kyat3 A T 3: 142,723,179 D89V possibly damaging Het
Lnpep A T 17: 17,562,836 F568I probably damaging Het
Lpl T C 8: 68,902,291 F444L possibly damaging Het
Lrp1 A T 10: 127,553,707 V3153E probably damaging Het
Lrrn1 A T 6: 107,567,568 N109I probably benign Het
Mcoln2 A C 3: 146,175,472 D166A possibly damaging Het
Ms4a6b A T 19: 11,523,934 I103F probably damaging Het
Mtmr10 T G 7: 64,337,466 S585A probably benign Het
Mx1 T C 16: 97,455,637 N114S possibly damaging Het
Mysm1 A T 4: 94,970,686 N75K probably benign Het
Nkx1-1 A G 5: 33,433,933 V15A unknown Het
Nlrp1a T A 11: 71,107,980 probably benign Het
Nlrp1a G A 11: 71,122,747 T559I possibly damaging Het
Oas1f A G 5: 120,855,589 K288R probably benign Het
Olfr1494 T A 19: 13,749,347 D80E probably benign Het
Olfr311 T A 11: 58,841,431 C106S probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pcdhb5 C T 18: 37,321,469 R301* probably null Het
Phf12 T C 11: 78,024,954 probably benign Het
Pik3c2a C T 7: 116,368,117 D862N probably benign Het
Pkhd1l1 T A 15: 44,503,345 L740I possibly damaging Het
Ppp1r9a A T 6: 5,111,060 probably benign Het
Prg4 T C 1: 150,452,009 D820G probably benign Het
Prmt9 C T 8: 77,555,674 Q67* probably null Het
Prob1 T C 18: 35,653,575 E542G possibly damaging Het
Pttg1 A G 11: 43,420,366 V188A probably damaging Het
Rassf1 T A 9: 107,558,193 L260H probably damaging Het
Rbm5 T A 9: 107,742,414 Q766L probably damaging Het
Rbms3 T A 9: 116,822,868 Y137F probably damaging Het
Rccd1 T C 7: 80,320,218 probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Setd4 T A 16: 93,591,299 K100* probably null Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Slc16a1 G T 3: 104,650,939 A91S probably benign Het
Slc36a1 A G 11: 55,220,453 N133S probably benign Het
Svil C T 18: 5,063,383 P885S probably benign Het
Svop A T 5: 114,060,056 probably null Het
Taar7d T C 10: 24,027,576 Y119H probably damaging Het
Tgfb3 T C 12: 86,062,044 T304A probably benign Het
Tmem94 C A 11: 115,793,213 C786* probably null Het
Tnfrsf4 T A 4: 156,016,279 probably null Het
Tns1 C A 1: 73,953,634 M1I probably null Het
Trappc13 C T 13: 104,169,819 probably null Het
Trim72 T C 7: 128,007,844 F182L possibly damaging Het
Ttc6 T C 12: 57,660,247 S647P probably benign Het
Tulp1 A G 17: 28,356,367 L400P possibly damaging Het
Vegfc C T 8: 54,181,312 T342M possibly damaging Het
Vit T A 17: 78,534,676 V15E probably benign Het
Vps13d A T 4: 145,155,003 M1334K probably damaging Het
Zfp280d T C 9: 72,298,780 V23A probably damaging Het
Zfp608 A G 18: 54,898,576 I764T probably benign Het
Zfp94 T C 7: 24,309,115 Y33C probably damaging Het
Zfyve26 T A 12: 79,269,049 I1218F probably damaging Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87418490 missense probably benign 0.03
IGL01139:Ltn1 APN 16 87416009 missense probably benign 0.04
IGL01359:Ltn1 APN 16 87405693 splice site probably benign
IGL01503:Ltn1 APN 16 87420807 critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87381471 missense probably benign 0.00
IGL02437:Ltn1 APN 16 87398001 missense probably benign 0.04
IGL02658:Ltn1 APN 16 87415774 missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87409297 splice site probably null
IGL02899:Ltn1 APN 16 87382659 missense probably benign 0.34
IGL02902:Ltn1 APN 16 87379805 missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87415944 missense probably benign 0.00
IGL03392:Ltn1 APN 16 87425611 missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87405621 missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87420323 missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87380840 nonsense probably null
R0126:Ltn1 UTSW 16 87425640 missense probably benign 0.00
R0164:Ltn1 UTSW 16 87405519 splice site probably benign
R0165:Ltn1 UTSW 16 87405519 splice site probably benign
R0280:Ltn1 UTSW 16 87397838 missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87416010 missense probably benign 0.01
R0733:Ltn1 UTSW 16 87412507 missense probably benign 0.01
R1034:Ltn1 UTSW 16 87397137 intron probably null
R1252:Ltn1 UTSW 16 87416030 missense probably benign 0.00
R1524:Ltn1 UTSW 16 87381556 missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87411781 missense possibly damaging 0.86
R1831:Ltn1 UTSW 16 87400146 missense possibly damaging 0.94
R1839:Ltn1 UTSW 16 87416264 nonsense probably null
R1860:Ltn1 UTSW 16 87416343 missense probably benign 0.06
R1997:Ltn1 UTSW 16 87381637 missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87415642 missense probably benign 0.03
R2134:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87427647 missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87432424 critical splice donor site probably null
R2376:Ltn1 UTSW 16 87420807 critical splice donor site probably null
R3054:Ltn1 UTSW 16 87404073 missense probably benign 0.32
R3404:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87420899 missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87397988 missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87405614 missense probably benign 0.17
R4535:Ltn1 UTSW 16 87426286 missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87402024 critical splice donor site probably null
R4669:Ltn1 UTSW 16 87418487 missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87379694 missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87398809 nonsense probably null
R4961:Ltn1 UTSW 16 87397791 missense probably benign
R4992:Ltn1 UTSW 16 87405587 missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87427740 missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87416011 missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87415681 missense probably benign 0.17
R5907:Ltn1 UTSW 16 87381503 missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87427789 missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87415810 missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87411774 missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87420306 missense probably benign
R6481:Ltn1 UTSW 16 87378980 missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87420186 missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87397791 missense probably benign
R6969:Ltn1 UTSW 16 87415690 missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87423473 missense probably benign
R7038:Ltn1 UTSW 16 87424871 missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87427603 missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87427641 missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87409387 missense probably benign 0.00
X0028:Ltn1 UTSW 16 87402134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTTTAAAGTGACATTCAGAGTCC -3'
(R):5'- TGTCAACGAGCGGAAGTCAG -3'

Sequencing Primer
(F):5'- TGACATTCAGAGTCCAGTGAG -3'
(R):5'- CGGAAGTCAGAGCAGCACC -3'
Posted On2014-06-23