Incidental Mutation 'R1827:Adgrb3'
ID206867
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission 039854-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R1827 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25532577 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 420 (T420A)
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably damaging
Transcript: ENSMUST00000041838
AA Change: T420A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: T420A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135518
AA Change: T420A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: T420A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146592
AA Change: T213A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: T213A

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151309
AA Change: T420A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: T420A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189254
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb G C 7: 131,441,275 R355T probably damaging Het
Ackr2 C T 9: 121,909,515 R319C probably benign Het
Acot4 G A 12: 84,041,938 A187T probably damaging Het
Adgrb2 A C 4: 130,012,557 Q926P probably damaging Het
Adra1b A T 11: 43,835,649 V147E probably damaging Het
Bco1 A G 8: 117,105,759 Y98C probably damaging Het
C87977 G A 4: 144,209,610 P27S probably damaging Het
Car5a C T 8: 121,923,808 V166M probably benign Het
Cdh5 T C 8: 104,112,909 L4P possibly damaging Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cmya5 G A 13: 93,074,448 T3279I possibly damaging Het
Col4a4 C T 1: 82,539,988 G105D unknown Het
Cyp2d34 A T 15: 82,616,094 H481Q probably benign Het
Dhx15 A T 5: 52,170,080 C307* probably null Het
Dnah9 A G 11: 65,850,061 Y4100H probably damaging Het
Dock10 T C 1: 80,530,292 N1647S probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
Esyt1 T C 10: 128,516,369 E763G probably benign Het
Fbxo18 G T 2: 11,763,888 D332E possibly damaging Het
Fndc8 G A 11: 82,899,529 V275M probably damaging Het
Focad T G 4: 88,229,383 Y420D probably benign Het
Gml A T 15: 74,816,431 H62Q probably benign Het
Gpr158 A T 2: 21,827,318 L1076F probably benign Het
Gpr161 A G 1: 165,306,567 T133A possibly damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gsg1l A T 7: 125,910,197 I256K possibly damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hnf1a G A 5: 114,960,195 A116V probably damaging Het
Hrh4 A T 18: 13,022,204 T267S probably damaging Het
Igfals A T 17: 24,880,304 N123I probably benign Het
Iglon5 T A 7: 43,479,121 T91S probably benign Het
Impg2 A T 16: 56,267,220 N1134I possibly damaging Het
Incenp A G 19: 9,872,729 V860A possibly damaging Het
Irf5 A T 6: 29,536,673 H461L possibly damaging Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kank2 A G 9: 21,795,465 S86P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnn3 A T 3: 89,520,994 M176L possibly damaging Het
Mccc1 A T 3: 35,985,001 I281N probably damaging Het
Mms19 G A 19: 41,953,677 A584V probably benign Het
Mon2 A T 10: 123,046,311 D184E probably damaging Het
Mrpl1 T C 5: 96,226,343 V159A possibly damaging Het
Myo18a C T 11: 77,818,771 T190I probably benign Het
Myo7a A T 7: 98,076,731 M1038K probably damaging Het
Myrfl T A 10: 116,832,947 I304F probably damaging Het
Neo1 G A 9: 58,917,031 R705* probably null Het
Nfat5 T C 8: 107,367,334 S736P probably benign Het
Nlrp4c C T 7: 6,065,766 P222L probably damaging Het
Nmt1 T A 11: 103,064,838 W481R probably damaging Het
Ntrk3 T A 7: 78,247,301 I663L probably damaging Het
Nup210l A T 3: 90,154,557 E681V probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr504 A T 7: 108,565,075 V240D probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pald1 ATGCTGCTGCTGCTGC ATGCTGCTGCTGC 10: 61,355,922 probably benign Het
Ppm1e T C 11: 87,231,695 T479A probably damaging Het
Ppp1r7 A G 1: 93,360,796 E298G probably benign Het
Prkaca T C 8: 83,990,987 probably null Het
Prss36 A G 7: 127,933,492 V718A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rrp12 G C 19: 41,880,481 D519E possibly damaging Het
Rufy4 T C 1: 74,134,120 L415P probably damaging Het
Ryk T A 9: 102,888,507 D335E probably benign Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Scin T C 12: 40,068,923 R625G possibly damaging Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Skiv2l2 C A 13: 112,913,099 probably null Het
Slc28a1 T C 7: 81,138,202 V279A possibly damaging Het
Slc30a8 T A 15: 52,331,557 probably null Het
Slco6d1 A G 1: 98,421,216 D4G probably damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Trpm1 G A 7: 64,235,007 R812H probably damaging Het
Tsga10 T A 1: 37,835,580 I75F probably damaging Het
Tyms C T 5: 30,062,016 probably null Het
Ubr4 A G 4: 139,425,697 probably null Het
Unc45a A G 7: 80,331,740 V438A possibly damaging Het
Usf2 T C 7: 30,955,340 D110G probably damaging Het
Vit T C 17: 78,546,446 probably null Het
Vmn2r104 A T 17: 20,042,235 M211K probably damaging Het
Vmn2r11 T C 5: 109,052,072 H505R probably benign Het
Vmn2r77 G A 7: 86,801,613 A236T probably damaging Het
Xpo1 T C 11: 23,285,155 M608T probably benign Het
Zfp112 T C 7: 24,124,960 F116L probably damaging Het
Zfp84 A G 7: 29,777,343 T487A possibly damaging Het
Zfpl1 A C 19: 6,081,871 L241R probably benign Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25131269 missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25531876 missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25532630 missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25531919 nonsense probably null
R7489:Adgrb3 UTSW 1 25547505 missense probably damaging 1.00
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTCATTGTATGACTGTCTGGC -3'
(R):5'- TGGAGAGGTAATATAGTCCCATGC -3'

Sequencing Primer
(F):5'- ACTGTCTGGCGTGGCTC -3'
(R):5'- TAGTCCCATGCAGAGTGATCTAC -3'
Posted On2014-06-23