Incidental Mutation 'R1827:Duox1'
ID206879
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission 039854-MU
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1827 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 122347380 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1548 (Y1548*)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000099461] [ENSMUST00000110530] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000121237] [ENSMUST00000125826] [ENSMUST00000139819]
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099461
AA Change: Y1548*
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: Y1548*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110530
SMART Domains Protein: ENSMUSP00000106159
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
SH2 130 214 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110532
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121237
SMART Domains Protein: ENSMUSP00000113923
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125826
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135848
Predicted Effect probably benign
Transcript: ENSMUST00000139819
SMART Domains Protein: ENSMUSP00000119980
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
SH2 218 302 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143484
SMART Domains Protein: ENSMUSP00000120732
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
SH2 71 155 3.19e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb G C 7: 131,441,275 R355T probably damaging Het
Ackr2 C T 9: 121,909,515 R319C probably benign Het
Acot4 G A 12: 84,041,938 A187T probably damaging Het
Adgrb2 A C 4: 130,012,557 Q926P probably damaging Het
Adgrb3 T C 1: 25,532,577 T420A probably damaging Het
Adra1b A T 11: 43,835,649 V147E probably damaging Het
Bco1 A G 8: 117,105,759 Y98C probably damaging Het
C87977 G A 4: 144,209,610 P27S probably damaging Het
Car5a C T 8: 121,923,808 V166M probably benign Het
Cdh5 T C 8: 104,112,909 L4P possibly damaging Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cmya5 G A 13: 93,074,448 T3279I possibly damaging Het
Col4a4 C T 1: 82,539,988 G105D unknown Het
Cyp2d34 A T 15: 82,616,094 H481Q probably benign Het
Dhx15 A T 5: 52,170,080 C307* probably null Het
Dnah9 A G 11: 65,850,061 Y4100H probably damaging Het
Dock10 T C 1: 80,530,292 N1647S probably benign Het
Esyt1 T C 10: 128,516,369 E763G probably benign Het
Fbxo18 G T 2: 11,763,888 D332E possibly damaging Het
Fndc8 G A 11: 82,899,529 V275M probably damaging Het
Focad T G 4: 88,229,383 Y420D probably benign Het
Gml A T 15: 74,816,431 H62Q probably benign Het
Gpr158 A T 2: 21,827,318 L1076F probably benign Het
Gpr161 A G 1: 165,306,567 T133A possibly damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gsg1l A T 7: 125,910,197 I256K possibly damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hnf1a G A 5: 114,960,195 A116V probably damaging Het
Hrh4 A T 18: 13,022,204 T267S probably damaging Het
Igfals A T 17: 24,880,304 N123I probably benign Het
Iglon5 T A 7: 43,479,121 T91S probably benign Het
Impg2 A T 16: 56,267,220 N1134I possibly damaging Het
Incenp A G 19: 9,872,729 V860A possibly damaging Het
Irf5 A T 6: 29,536,673 H461L possibly damaging Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kank2 A G 9: 21,795,465 S86P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnn3 A T 3: 89,520,994 M176L possibly damaging Het
Mccc1 A T 3: 35,985,001 I281N probably damaging Het
Mms19 G A 19: 41,953,677 A584V probably benign Het
Mon2 A T 10: 123,046,311 D184E probably damaging Het
Mrpl1 T C 5: 96,226,343 V159A possibly damaging Het
Myo18a C T 11: 77,818,771 T190I probably benign Het
Myo7a A T 7: 98,076,731 M1038K probably damaging Het
Myrfl T A 10: 116,832,947 I304F probably damaging Het
Neo1 G A 9: 58,917,031 R705* probably null Het
Nfat5 T C 8: 107,367,334 S736P probably benign Het
Nlrp4c C T 7: 6,065,766 P222L probably damaging Het
Nmt1 T A 11: 103,064,838 W481R probably damaging Het
Ntrk3 T A 7: 78,247,301 I663L probably damaging Het
Nup210l A T 3: 90,154,557 E681V probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr504 A T 7: 108,565,075 V240D probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pald1 ATGCTGCTGCTGCTGC ATGCTGCTGCTGC 10: 61,355,922 probably benign Het
Ppm1e T C 11: 87,231,695 T479A probably damaging Het
Ppp1r7 A G 1: 93,360,796 E298G probably benign Het
Prkaca T C 8: 83,990,987 probably null Het
Prss36 A G 7: 127,933,492 V718A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rrp12 G C 19: 41,880,481 D519E possibly damaging Het
Rufy4 T C 1: 74,134,120 L415P probably damaging Het
Ryk T A 9: 102,888,507 D335E probably benign Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Scin T C 12: 40,068,923 R625G possibly damaging Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Skiv2l2 C A 13: 112,913,099 probably null Het
Slc28a1 T C 7: 81,138,202 V279A possibly damaging Het
Slc30a8 T A 15: 52,331,557 probably null Het
Slco6d1 A G 1: 98,421,216 D4G probably damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Trpm1 G A 7: 64,235,007 R812H probably damaging Het
Tsga10 T A 1: 37,835,580 I75F probably damaging Het
Tyms C T 5: 30,062,016 probably null Het
Ubr4 A G 4: 139,425,697 probably null Het
Unc45a A G 7: 80,331,740 V438A possibly damaging Het
Usf2 T C 7: 30,955,340 D110G probably damaging Het
Vit T C 17: 78,546,446 probably null Het
Vmn2r104 A T 17: 20,042,235 M211K probably damaging Het
Vmn2r11 T C 5: 109,052,072 H505R probably benign Het
Vmn2r77 G A 7: 86,801,613 A236T probably damaging Het
Xpo1 T C 11: 23,285,155 M608T probably benign Het
Zfp112 T C 7: 24,124,960 F116L probably damaging Het
Zfp84 A G 7: 29,777,343 T487A possibly damaging Het
Zfpl1 A C 19: 6,081,871 L241R probably benign Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 intron probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGAACATGAACCTGGCTAC -3'
(R):5'- AGACACATTCTGGCCCTAGAG -3'

Sequencing Primer
(F):5'- GAACATGAACCTGGCTACTGTTTTG -3'
(R):5'- GAGATCTCTGAGCCTACACATGATG -3'
Posted On2014-06-23