Incidental Mutation 'R1827:Itpr2'
ID206901
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Nameinositol 1,4,5-triphosphate receptor 2
SynonymsItpr5, Ip3r2
MMRRC Submission 039854-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1827 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location146108299-146502223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146328332 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1255 (L1255P)
Ref Sequence ENSEMBL: ENSMUSP00000049584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]
Predicted Effect probably damaging
Transcript: ENSMUST00000053273
AA Change: L1255P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: L1255P

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079573
AA Change: L1222P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: L1222P

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb G C 7: 131,441,275 R355T probably damaging Het
Ackr2 C T 9: 121,909,515 R319C probably benign Het
Acot4 G A 12: 84,041,938 A187T probably damaging Het
Adgrb2 A C 4: 130,012,557 Q926P probably damaging Het
Adgrb3 T C 1: 25,532,577 T420A probably damaging Het
Adra1b A T 11: 43,835,649 V147E probably damaging Het
Bco1 A G 8: 117,105,759 Y98C probably damaging Het
C87977 G A 4: 144,209,610 P27S probably damaging Het
Car5a C T 8: 121,923,808 V166M probably benign Het
Cdh5 T C 8: 104,112,909 L4P possibly damaging Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cmya5 G A 13: 93,074,448 T3279I possibly damaging Het
Col4a4 C T 1: 82,539,988 G105D unknown Het
Cyp2d34 A T 15: 82,616,094 H481Q probably benign Het
Dhx15 A T 5: 52,170,080 C307* probably null Het
Dnah9 A G 11: 65,850,061 Y4100H probably damaging Het
Dock10 T C 1: 80,530,292 N1647S probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
Esyt1 T C 10: 128,516,369 E763G probably benign Het
Fbxo18 G T 2: 11,763,888 D332E possibly damaging Het
Fndc8 G A 11: 82,899,529 V275M probably damaging Het
Focad T G 4: 88,229,383 Y420D probably benign Het
Gml A T 15: 74,816,431 H62Q probably benign Het
Gpr158 A T 2: 21,827,318 L1076F probably benign Het
Gpr161 A G 1: 165,306,567 T133A possibly damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gsg1l A T 7: 125,910,197 I256K possibly damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hnf1a G A 5: 114,960,195 A116V probably damaging Het
Hrh4 A T 18: 13,022,204 T267S probably damaging Het
Igfals A T 17: 24,880,304 N123I probably benign Het
Iglon5 T A 7: 43,479,121 T91S probably benign Het
Impg2 A T 16: 56,267,220 N1134I possibly damaging Het
Incenp A G 19: 9,872,729 V860A possibly damaging Het
Irf5 A T 6: 29,536,673 H461L possibly damaging Het
Kank2 A G 9: 21,795,465 S86P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnn3 A T 3: 89,520,994 M176L possibly damaging Het
Mccc1 A T 3: 35,985,001 I281N probably damaging Het
Mms19 G A 19: 41,953,677 A584V probably benign Het
Mon2 A T 10: 123,046,311 D184E probably damaging Het
Mrpl1 T C 5: 96,226,343 V159A possibly damaging Het
Myo18a C T 11: 77,818,771 T190I probably benign Het
Myo7a A T 7: 98,076,731 M1038K probably damaging Het
Myrfl T A 10: 116,832,947 I304F probably damaging Het
Neo1 G A 9: 58,917,031 R705* probably null Het
Nfat5 T C 8: 107,367,334 S736P probably benign Het
Nlrp4c C T 7: 6,065,766 P222L probably damaging Het
Nmt1 T A 11: 103,064,838 W481R probably damaging Het
Ntrk3 T A 7: 78,247,301 I663L probably damaging Het
Nup210l A T 3: 90,154,557 E681V probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr504 A T 7: 108,565,075 V240D probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pald1 ATGCTGCTGCTGCTGC ATGCTGCTGCTGC 10: 61,355,922 probably benign Het
Ppm1e T C 11: 87,231,695 T479A probably damaging Het
Ppp1r7 A G 1: 93,360,796 E298G probably benign Het
Prkaca T C 8: 83,990,987 probably null Het
Prss36 A G 7: 127,933,492 V718A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rrp12 G C 19: 41,880,481 D519E possibly damaging Het
Rufy4 T C 1: 74,134,120 L415P probably damaging Het
Ryk T A 9: 102,888,507 D335E probably benign Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Scin T C 12: 40,068,923 R625G possibly damaging Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Skiv2l2 C A 13: 112,913,099 probably null Het
Slc28a1 T C 7: 81,138,202 V279A possibly damaging Het
Slc30a8 T A 15: 52,331,557 probably null Het
Slco6d1 A G 1: 98,421,216 D4G probably damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Trpm1 G A 7: 64,235,007 R812H probably damaging Het
Tsga10 T A 1: 37,835,580 I75F probably damaging Het
Tyms C T 5: 30,062,016 probably null Het
Ubr4 A G 4: 139,425,697 probably null Het
Unc45a A G 7: 80,331,740 V438A possibly damaging Het
Usf2 T C 7: 30,955,340 D110G probably damaging Het
Vit T C 17: 78,546,446 probably null Het
Vmn2r104 A T 17: 20,042,235 M211K probably damaging Het
Vmn2r11 T C 5: 109,052,072 H505R probably benign Het
Vmn2r77 G A 7: 86,801,613 A236T probably damaging Het
Xpo1 T C 11: 23,285,155 M608T probably benign Het
Zfp112 T C 7: 24,124,960 F116L probably damaging Het
Zfp84 A G 7: 29,777,343 T487A possibly damaging Het
Zfpl1 A C 19: 6,081,871 L241R probably benign Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146397012 missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146390836 missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146144185 missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146232436 missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146158961 missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146310981 splice site probably benign
IGL01012:Itpr2 APN 6 146345161 missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146112535 nonsense probably null
IGL01411:Itpr2 APN 6 146376062 critical splice donor site probably null
IGL01557:Itpr2 APN 6 146158976 missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146180229 missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146227581 missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146232546 missense probably benign 0.02
IGL02198:Itpr2 APN 6 146323227 missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146240262 splice site probably benign
IGL02332:Itpr2 APN 6 146426542 missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146391321 missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146325173 missense probably benign 0.05
IGL02726:Itpr2 APN 6 146375921 missense probably benign 0.18
IGL02851:Itpr2 APN 6 146385979 missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146312904 missense probably benign
IGL03015:Itpr2 APN 6 146375937 missense probably benign
IGL03067:Itpr2 APN 6 146325182 missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146379510 missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146180244 missense probably benign 0.02
IGL03275:Itpr2 APN 6 146158877 splice site probably benign
IGL03332:Itpr2 APN 6 146144149 missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146157104 missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146329715 missense probably damaging 0.96
IGL03377:Itpr2 APN 6 146329758 missense probably benign
enfermos UTSW 6 146234006 missense probably damaging 0.98
P0029:Itpr2 UTSW 6 146379489 missense probably damaging 1.00
PIT4431001:Itpr2 UTSW 6 146354720 missense probably benign
PIT4453001:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
PIT4504001:Itpr2 UTSW 6 146229871 missense probably damaging 0.99
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0088:Itpr2 UTSW 6 146241185 missense probably benign
R0089:Itpr2 UTSW 6 146350022 critical splice donor site probably null
R0114:Itpr2 UTSW 6 146312879 missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146240453 missense probably benign 0.00
R0144:Itpr2 UTSW 6 146327155 missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146501909 start gained probably benign
R0211:Itpr2 UTSW 6 146194613 missense probably benign 0.17
R0305:Itpr2 UTSW 6 146311103 missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146234008 missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146359392 missense probably benign 0.00
R0391:Itpr2 UTSW 6 146229773 missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146375889 missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146112400 missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146166651 missense probably benign
R0633:Itpr2 UTSW 6 146374456 missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146171412 missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146350045 missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146111742 missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146180290 missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146376148 missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146350068 missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146158901 nonsense probably null
R1796:Itpr2 UTSW 6 146296673 missense probably benign
R1815:Itpr2 UTSW 6 146359416 missense probably benign 0.08
R1828:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146385971 missense probably benign 0.16
R1902:Itpr2 UTSW 6 146229703 missense probably damaging 1.00
R1931:Itpr2 UTSW 6 146240354 missense probably benign 0.41
R1964:Itpr2 UTSW 6 146111693 missense probably damaging 1.00
R2010:Itpr2 UTSW 6 146227524 synonymous probably null
R2168:Itpr2 UTSW 6 146111678 missense probably benign 0.05
R2179:Itpr2 UTSW 6 146375966 missense probably benign
R2290:Itpr2 UTSW 6 146422828 missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146426498 missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146171293 missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2897:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2898:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R3024:Itpr2 UTSW 6 146180310 missense probably benign 0.35
R3104:Itpr2 UTSW 6 146312837 critical splice donor site probably null
R3607:Itpr2 UTSW 6 146227601 missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146415354 missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146232291 splice site probably null
R3821:Itpr2 UTSW 6 146417726 missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146374359 splice site probably null
R3958:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146229764 missense probably damaging 1.00
R3960:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4074:Itpr2 UTSW 6 146373244 splice site probably null
R4085:Itpr2 UTSW 6 146144248 missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146241196 missense probably benign 0.33
R4663:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4684:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146229775 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146396958 missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4801:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146325205 missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146240342 missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146144107 critical splice donor site probably null
R5224:Itpr2 UTSW 6 146166651 missense probably benign
R5243:Itpr2 UTSW 6 146187546 missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146476693 missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146376155 nonsense probably null
R5552:Itpr2 UTSW 6 146294080 missense probably benign
R5579:Itpr2 UTSW 6 146173366 nonsense probably null
R5744:Itpr2 UTSW 6 146376151 missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146144149 missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146329571 missense probably benign 0.10
R5911:Itpr2 UTSW 6 146312943 missense probably benign 0.42
R6044:Itpr2 UTSW 6 146396951 missense probably null 0.98
R6072:Itpr2 UTSW 6 146347111 missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146328335 missense probably benign 0.01
R6483:Itpr2 UTSW 6 146112477 missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146329727 missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146345211 missense probably benign 0.01
R6561:Itpr2 UTSW 6 146234006 missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146190480 missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146347171 missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146325170 missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146385873 critical splice donor site probably null
R6831:Itpr2 UTSW 6 146112429 missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146397019 nonsense probably null
R7103:Itpr2 UTSW 6 146325074 missense probably damaging 1.00
R7111:Itpr2 UTSW 6 146325056 missense probably damaging 1.00
R7126:Itpr2 UTSW 6 146357796 nonsense probably null
R7165:Itpr2 UTSW 6 146294091 missense probably damaging 1.00
R7184:Itpr2 UTSW 6 146311087 missense possibly damaging 0.79
R7249:Itpr2 UTSW 6 146311052 missense probably damaging 1.00
R7292:Itpr2 UTSW 6 146158949 missense possibly damaging 0.95
R7342:Itpr2 UTSW 6 146327187 missense probably damaging 0.98
R7392:Itpr2 UTSW 6 146359340 missense possibly damaging 0.95
V8831:Itpr2 UTSW 6 146385882 missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146323236 missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146180353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACGAGGCTGCCATTGAC -3'
(R):5'- CATGGAGGAAAGCGCCCATG -3'

Sequencing Primer
(F):5'- CGAGGCTGCCATTGACATATAG -3'
(R):5'- GAGTACGTGCTATGTGGGC -3'
Posted On2014-06-23