Incidental Mutation 'R1827:Acadsb'
ID206918
Institutional Source Beutler Lab
Gene Symbol Acadsb
Ensembl Gene ENSMUSG00000030861
Gene Nameacyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms1300003O09Rik
MMRRC Submission 039854-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1827 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location131410601-131448944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 131441275 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 355 (R355T)
Ref Sequence ENSEMBL: ENSMUSP00000113948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015829] [ENSMUST00000117518] [ENSMUST00000124096]
Predicted Effect probably damaging
Transcript: ENSMUST00000015829
AA Change: R355T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015829
Gene: ENSMUSG00000030861
AA Change: R355T

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 9.9e-30 PFAM
Pfam:Acyl-CoA_dh_M 173 268 6.9e-29 PFAM
Pfam:Acyl-CoA_dh_1 280 428 6.5e-51 PFAM
Pfam:Acyl-CoA_dh_2 295 418 4.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117518
AA Change: R355T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113948
Gene: ENSMUSG00000030861
AA Change: R355T

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 2.9e-29 PFAM
Pfam:Acyl-CoA_dh_M 173 268 1.2e-28 PFAM
Pfam:Acyl-CoA_dh_1 280 414 1.4e-41 PFAM
Pfam:Acyl-CoA_dh_2 295 415 2.6e-24 PFAM
transmembrane domain 417 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208795
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short/branched chain acyl-CoA dehydrogenase(ACADSB) is a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. Substrate specificity is the primary characteristic used to define members of this gene family. The ACADSB gene product has the greatest activity towards the short branched chain acyl-CoA derivative, (S)-2-methylbutyryl-CoA, but also reacts significantly with other 2-methyl branched chain substrates and with short straight chain acyl-CoAs. The cDNA encodes for a mitochondrial precursor protein which is cleaved upon mitochondrial import and predicted to yield a mature peptide of approximately 43.7-KDa. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 C T 9: 121,909,515 R319C probably benign Het
Acot4 G A 12: 84,041,938 A187T probably damaging Het
Adgrb2 A C 4: 130,012,557 Q926P probably damaging Het
Adgrb3 T C 1: 25,532,577 T420A probably damaging Het
Adra1b A T 11: 43,835,649 V147E probably damaging Het
Bco1 A G 8: 117,105,759 Y98C probably damaging Het
C87977 G A 4: 144,209,610 P27S probably damaging Het
Car5a C T 8: 121,923,808 V166M probably benign Het
Cdh5 T C 8: 104,112,909 L4P possibly damaging Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cmya5 G A 13: 93,074,448 T3279I possibly damaging Het
Col4a4 C T 1: 82,539,988 G105D unknown Het
Cyp2d34 A T 15: 82,616,094 H481Q probably benign Het
Dhx15 A T 5: 52,170,080 C307* probably null Het
Dnah9 A G 11: 65,850,061 Y4100H probably damaging Het
Dock10 T C 1: 80,530,292 N1647S probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
Esyt1 T C 10: 128,516,369 E763G probably benign Het
Fbxo18 G T 2: 11,763,888 D332E possibly damaging Het
Fndc8 G A 11: 82,899,529 V275M probably damaging Het
Focad T G 4: 88,229,383 Y420D probably benign Het
Gml A T 15: 74,816,431 H62Q probably benign Het
Gpr158 A T 2: 21,827,318 L1076F probably benign Het
Gpr161 A G 1: 165,306,567 T133A possibly damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gsg1l A T 7: 125,910,197 I256K possibly damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hnf1a G A 5: 114,960,195 A116V probably damaging Het
Hrh4 A T 18: 13,022,204 T267S probably damaging Het
Igfals A T 17: 24,880,304 N123I probably benign Het
Iglon5 T A 7: 43,479,121 T91S probably benign Het
Impg2 A T 16: 56,267,220 N1134I possibly damaging Het
Incenp A G 19: 9,872,729 V860A possibly damaging Het
Irf5 A T 6: 29,536,673 H461L possibly damaging Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kank2 A G 9: 21,795,465 S86P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kcnn3 A T 3: 89,520,994 M176L possibly damaging Het
Mccc1 A T 3: 35,985,001 I281N probably damaging Het
Mms19 G A 19: 41,953,677 A584V probably benign Het
Mon2 A T 10: 123,046,311 D184E probably damaging Het
Mrpl1 T C 5: 96,226,343 V159A possibly damaging Het
Myo18a C T 11: 77,818,771 T190I probably benign Het
Myo7a A T 7: 98,076,731 M1038K probably damaging Het
Myrfl T A 10: 116,832,947 I304F probably damaging Het
Neo1 G A 9: 58,917,031 R705* probably null Het
Nfat5 T C 8: 107,367,334 S736P probably benign Het
Nlrp4c C T 7: 6,065,766 P222L probably damaging Het
Nmt1 T A 11: 103,064,838 W481R probably damaging Het
Ntrk3 T A 7: 78,247,301 I663L probably damaging Het
Nup210l A T 3: 90,154,557 E681V probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr504 A T 7: 108,565,075 V240D probably benign Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Pald1 ATGCTGCTGCTGCTGC ATGCTGCTGCTGC 10: 61,355,922 probably benign Het
Ppm1e T C 11: 87,231,695 T479A probably damaging Het
Ppp1r7 A G 1: 93,360,796 E298G probably benign Het
Prkaca T C 8: 83,990,987 probably null Het
Prss36 A G 7: 127,933,492 V718A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rrp12 G C 19: 41,880,481 D519E possibly damaging Het
Rufy4 T C 1: 74,134,120 L415P probably damaging Het
Ryk T A 9: 102,888,507 D335E probably benign Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Scin T C 12: 40,068,923 R625G possibly damaging Het
Simc1 T A 13: 54,524,639 C267S probably benign Het
Skiv2l2 C A 13: 112,913,099 probably null Het
Slc28a1 T C 7: 81,138,202 V279A possibly damaging Het
Slc30a8 T A 15: 52,331,557 probably null Het
Slco6d1 A G 1: 98,421,216 D4G probably damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Trpm1 G A 7: 64,235,007 R812H probably damaging Het
Tsga10 T A 1: 37,835,580 I75F probably damaging Het
Tyms C T 5: 30,062,016 probably null Het
Ubr4 A G 4: 139,425,697 probably null Het
Unc45a A G 7: 80,331,740 V438A possibly damaging Het
Usf2 T C 7: 30,955,340 D110G probably damaging Het
Vit T C 17: 78,546,446 probably null Het
Vmn2r104 A T 17: 20,042,235 M211K probably damaging Het
Vmn2r11 T C 5: 109,052,072 H505R probably benign Het
Vmn2r77 G A 7: 86,801,613 A236T probably damaging Het
Xpo1 T C 11: 23,285,155 M608T probably benign Het
Zfp112 T C 7: 24,124,960 F116L probably damaging Het
Zfp84 A G 7: 29,777,343 T487A possibly damaging Het
Zfpl1 A C 19: 6,081,871 L241R probably benign Het
Other mutations in Acadsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Acadsb APN 7 131437496 intron probably benign
IGL02002:Acadsb APN 7 131428529 missense probably damaging 1.00
IGL02147:Acadsb APN 7 131425881 splice site probably benign
IGL02614:Acadsb APN 7 131424628 missense probably benign 0.00
IGL03038:Acadsb APN 7 131428456 missense probably damaging 1.00
IGL03083:Acadsb APN 7 131441193 intron probably benign
R0491:Acadsb UTSW 7 131430107 missense probably benign 0.41
R0562:Acadsb UTSW 7 131425789 nonsense probably null
R0989:Acadsb UTSW 7 131428544 missense probably damaging 0.99
R1701:Acadsb UTSW 7 131424484 missense probably benign 0.00
R1860:Acadsb UTSW 7 131444229 splice site probably null
R2256:Acadsb UTSW 7 131443653 missense probably benign 0.23
R3798:Acadsb UTSW 7 131431965 missense probably damaging 1.00
R4519:Acadsb UTSW 7 131430004 missense probably damaging 0.99
R5020:Acadsb UTSW 7 131441200 critical splice acceptor site probably null
R5048:Acadsb UTSW 7 131437469 missense probably damaging 1.00
R5243:Acadsb UTSW 7 131444243 missense probably damaging 1.00
R5519:Acadsb UTSW 7 131429965 missense probably damaging 1.00
R5788:Acadsb UTSW 7 131443599 missense probably benign 0.23
R5855:Acadsb UTSW 7 131424599 missense probably damaging 1.00
R6399:Acadsb UTSW 7 131430055 missense probably damaging 1.00
R6896:Acadsb UTSW 7 131443646 missense probably benign 0.23
R6970:Acadsb UTSW 7 131434315 missense possibly damaging 0.85
R7031:Acadsb UTSW 7 131443637 missense probably benign 0.23
R7126:Acadsb UTSW 7 131437448 missense probably benign 0.01
R7138:Acadsb UTSW 7 131441239 missense probably damaging 1.00
R7571:Acadsb UTSW 7 131443554 missense not run
Predicted Primers PCR Primer
(F):5'- AAAACCTAACCTTTTACGGTGC -3'
(R):5'- TGCCCTTCTACTGCAGGAAG -3'

Sequencing Primer
(F):5'- TTCACTTTAGATTGCAGACTTAAGG -3'
(R):5'- CCTTCTACTGCAGGAAGTGGAAAG -3'
Posted On2014-06-23