Incidental Mutation 'R1828:Olfr32'
ID206977
Institutional Source Beutler Lab
Gene Symbol Olfr32
Ensembl Gene ENSMUSG00000075066
Gene Nameolfactory receptor 32
SynonymsMOR227-9_p, GA_x6K02T2Q125-51573576-51572650, MOR227-7P, MTPCR05
MMRRC Submission 039855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1828 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90136273-90142296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90138587 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 184 (L184S)
Ref Sequence ENSEMBL: ENSMUSP00000150239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099755] [ENSMUST00000213293] [ENSMUST00000214973] [ENSMUST00000215153] [ENSMUST00000215659] [ENSMUST00000215765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099755
AA Change: L184S

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097344
Gene: ENSMUSG00000075066
AA Change: L184S

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.7e-52 PFAM
Pfam:7tm_1 38 284 6.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213293
AA Change: L184S

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214973
AA Change: L184S

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215153
AA Change: L184S

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000215659
AA Change: L184S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215765
AA Change: L184S

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Olfr32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr32 APN 2 90139074 missense probably benign 0.30
IGL01976:Olfr32 APN 2 90138924 missense probably damaging 1.00
IGL02076:Olfr32 APN 2 90138815 missense probably damaging 1.00
IGL03030:Olfr32 APN 2 90138662 missense possibly damaging 0.93
IGL03235:Olfr32 APN 2 90139070 missense possibly damaging 0.88
IGL03410:Olfr32 APN 2 90139145 start gained probably benign
R1240:Olfr32 UTSW 2 90138813 missense possibly damaging 0.48
R1511:Olfr32 UTSW 2 90138404 missense probably benign 0.13
R1602:Olfr32 UTSW 2 90139055 missense probably damaging 1.00
R2023:Olfr32 UTSW 2 90138856 nonsense probably null
R2177:Olfr32 UTSW 2 90138464 missense possibly damaging 0.70
R2679:Olfr32 UTSW 2 90138545 missense possibly damaging 0.93
R4490:Olfr32 UTSW 2 90138917 missense probably damaging 0.97
R4585:Olfr32 UTSW 2 90138214 missense probably benign 0.01
R4586:Olfr32 UTSW 2 90138214 missense probably benign 0.01
R4649:Olfr32 UTSW 2 90139088 missense probably damaging 0.99
R4688:Olfr32 UTSW 2 90138999 missense possibly damaging 0.80
R4694:Olfr32 UTSW 2 90138249 nonsense probably null
R5245:Olfr32 UTSW 2 90138262 missense probably damaging 1.00
R5509:Olfr32 UTSW 2 90138892 missense probably damaging 1.00
R5991:Olfr32 UTSW 2 90138234 nonsense probably null
R6004:Olfr32 UTSW 2 90138999 missense probably benign 0.32
R6128:Olfr32 UTSW 2 90138610 nonsense probably null
R6519:Olfr32 UTSW 2 90138812 missense possibly damaging 0.90
X0066:Olfr32 UTSW 2 90138390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAACCACCATGATGTGAG -3'
(R):5'- ACAGTGATGGCTTATGACCGC -3'

Sequencing Primer
(F):5'- GAGGCACAGGTAGATAAAGCCTTG -3'
(R):5'- GCTATGTGGCCATCTGCAAAC -3'
Posted On2014-06-23