Incidental Mutation 'R1828:Bub1b'
ID206978
Institutional Source Beutler Lab
Gene Symbol Bub1b
Ensembl Gene ENSMUSG00000040084
Gene NameBUB1B, mitotic checkpoint serine/threonine kinase
SynonymsBUBR1
MMRRC Submission 039855-MU
Accession Numbers

NM_009773; MGI: 1333889

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1828 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118598211-118641591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118638439 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 895 (H895R)
Ref Sequence ENSEMBL: ENSMUSP00000037126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038341]
Predicted Effect probably benign
Transcript: ENSMUST00000038341
AA Change: H895R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084
AA Change: H895R

DomainStartEndE-ValueType
PDB:4GGD|D 14 35 6e-6 PDB
Mad3_BUB1_I 49 173 1.83e-68 SMART
low complexity region 198 214 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
coiled coil region 418 457 N/A INTRINSIC
low complexity region 671 686 N/A INTRINSIC
low complexity region 717 726 N/A INTRINSIC
Pfam:Pkinase 806 942 4.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126013
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Bub1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Bub1b APN 2 118630138 missense probably benign
IGL01319:Bub1b APN 2 118614994 missense possibly damaging 0.49
IGL01744:Bub1b APN 2 118636749 missense probably damaging 0.99
IGL03184:Bub1b APN 2 118609777 splice site probably benign
P0035:Bub1b UTSW 2 118622185 missense probably damaging 1.00
R0315:Bub1b UTSW 2 118626976 splice site probably benign
R0322:Bub1b UTSW 2 118639618 splice site probably benign
R0378:Bub1b UTSW 2 118641123 missense probably benign 0.01
R0457:Bub1b UTSW 2 118609859 missense probably damaging 1.00
R0845:Bub1b UTSW 2 118609976 missense probably damaging 1.00
R0960:Bub1b UTSW 2 118606680 missense probably benign 0.03
R1071:Bub1b UTSW 2 118632447 frame shift probably null
R1129:Bub1b UTSW 2 118615006 missense probably damaging 1.00
R1138:Bub1b UTSW 2 118623089 missense probably benign 0.01
R1171:Bub1b UTSW 2 118606686 missense probably benign 0.31
R1613:Bub1b UTSW 2 118639741 critical splice donor site probably null
R1667:Bub1b UTSW 2 118641189 missense probably benign 0.00
R1812:Bub1b UTSW 2 118632421 missense probably benign 0.00
R2085:Bub1b UTSW 2 118622195 missense possibly damaging 0.88
R2137:Bub1b UTSW 2 118636718 nonsense probably null
R3749:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R3750:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R4211:Bub1b UTSW 2 118630978 missense possibly damaging 0.78
R4579:Bub1b UTSW 2 118623176 nonsense probably null
R4993:Bub1b UTSW 2 118636770 missense possibly damaging 0.63
R5144:Bub1b UTSW 2 118615499 missense possibly damaging 0.92
R5229:Bub1b UTSW 2 118629989 missense probably damaging 1.00
R5596:Bub1b UTSW 2 118630982 missense probably damaging 1.00
R5656:Bub1b UTSW 2 118605431 missense probably damaging 1.00
R5785:Bub1b UTSW 2 118609844 missense probably damaging 0.98
R5883:Bub1b UTSW 2 118609882 missense probably damaging 1.00
R6128:Bub1b UTSW 2 118617812 missense probably benign
R6187:Bub1b UTSW 2 118631000 missense probably damaging 1.00
R6333:Bub1b UTSW 2 118598463 critical splice donor site probably null
R6985:Bub1b UTSW 2 118606614 missense probably damaging 1.00
R6988:Bub1b UTSW 2 118636830 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCATGCACTGTGTTTTAGG -3'
(R):5'- AATGCTCTCCGTATTTGTCCAGG -3'

Sequencing Primer
(F):5'- GTGACCAAAGAAATCTTAACCCTTG -3'
(R):5'- AGGCTTGTCTTCCACTTACATGGTAG -3'
Posted On2014-06-23