Incidental Mutation 'R1828:Duox1'
ID206979
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission 039855-MU
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1828 (G1)
Quality Score178
Status Not validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 122347380 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1548 (Y1548*)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000099461] [ENSMUST00000110530] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000121237] [ENSMUST00000125826] [ENSMUST00000139819]
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099461
AA Change: Y1548*
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: Y1548*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110530
SMART Domains Protein: ENSMUSP00000106159
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
SH2 130 214 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110532
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121237
SMART Domains Protein: ENSMUSP00000113923
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125826
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135848
Predicted Effect probably benign
Transcript: ENSMUST00000139819
SMART Domains Protein: ENSMUSP00000119980
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
SH2 218 302 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143484
SMART Domains Protein: ENSMUSP00000120732
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
SH2 71 155 3.19e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6885:Duox1 UTSW 2 122324584 intron probably null
Predicted Primers PCR Primer
(F):5'- CAGGAACATGAACCTGGCTACTG -3'
(R):5'- GACACATTCTGGCCCTAGAG -3'

Sequencing Primer
(F):5'- GAACATGAACCTGGCTACTGTTTTG -3'
(R):5'- GAGATCTCTGAGCCTACACATGATG -3'
Posted On2014-06-23