Incidental Mutation 'R1828:Anxa2'
ID207027
Institutional Source Beutler Lab
Gene Symbol Anxa2
Ensembl Gene ENSMUSG00000032231
Gene Nameannexin A2
Synonymslipocortin II, annexin II, Cal1h, 36-kDa calelectrin
MMRRC Submission 039855-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1828 (G1)
Quality Score196
Status Not validated
Chromosome9
Chromosomal Location69453620-69491795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69482978 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 121 (L121Q)
Ref Sequence ENSEMBL: ENSMUSP00000122175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034756] [ENSMUST00000123470] [ENSMUST00000134907] [ENSMUST00000136282]
Predicted Effect probably damaging
Transcript: ENSMUST00000034756
AA Change: L121Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034756
Gene: ENSMUSG00000032231
AA Change: L121Q

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
ANX 207 259 8.2e-11 SMART
ANX 282 334 1.6e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123470
AA Change: L121Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122175
Gene: ENSMUSG00000032231
AA Change: L121Q

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131093
Predicted Effect probably damaging
Transcript: ENSMUST00000134907
AA Change: L121Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117979
Gene: ENSMUSG00000032231
AA Change: L121Q

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136282
AA Change: L54Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117855
Gene: ENSMUSG00000032231
AA Change: L54Q

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
ANX 55 107 1.5e-27 SMART
ANX 140 192 8.2e-11 SMART
ANX 215 267 1.6e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154591
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but suffer from growth deficits, impaired angiogenesis, and increased susceptibility to thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Anxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Anxa2 APN 9 69483019 nonsense probably null
IGL02550:Anxa2 APN 9 69467306 missense probably benign 0.00
FR4342:Anxa2 UTSW 9 69480205 small insertion probably benign
FR4342:Anxa2 UTSW 9 69480210 small insertion probably benign
FR4548:Anxa2 UTSW 9 69480203 small insertion probably benign
FR4589:Anxa2 UTSW 9 69480210 small insertion probably benign
R1480:Anxa2 UTSW 9 69489754 frame shift probably null
R1482:Anxa2 UTSW 9 69489754 frame shift probably null
R1519:Anxa2 UTSW 9 69485241 missense probably damaging 1.00
R1609:Anxa2 UTSW 9 69489754 frame shift probably null
R1610:Anxa2 UTSW 9 69489754 frame shift probably null
R1624:Anxa2 UTSW 9 69479708 missense probably benign 0.10
R1672:Anxa2 UTSW 9 69489754 frame shift probably null
R1696:Anxa2 UTSW 9 69489754 frame shift probably null
R1760:Anxa2 UTSW 9 69489767 missense probably benign 0.00
R1775:Anxa2 UTSW 9 69488081 missense possibly damaging 0.93
R1884:Anxa2 UTSW 9 69489754 frame shift probably null
R1991:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2020:Anxa2 UTSW 9 69483817 missense probably damaging 0.99
R2029:Anxa2 UTSW 9 69464480 missense possibly damaging 0.71
R2103:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2129:Anxa2 UTSW 9 69476128 missense possibly damaging 0.48
R2146:Anxa2 UTSW 9 69489754 frame shift probably null
R2148:Anxa2 UTSW 9 69489754 frame shift probably null
R2149:Anxa2 UTSW 9 69489754 frame shift probably null
R2150:Anxa2 UTSW 9 69489754 frame shift probably null
R2437:Anxa2 UTSW 9 69489764 missense probably damaging 1.00
R3848:Anxa2 UTSW 9 69467342 missense probably damaging 1.00
R4036:Anxa2 UTSW 9 69488070 missense probably damaging 0.99
R4565:Anxa2 UTSW 9 69489737 missense probably damaging 1.00
R4731:Anxa2 UTSW 9 69486530 missense probably benign 0.41
R5172:Anxa2 UTSW 9 69485251 missense probably damaging 0.99
R5181:Anxa2 UTSW 9 69476065 missense probably benign 0.00
R6427:Anxa2 UTSW 9 69476149 critical splice donor site probably null
R6759:Anxa2 UTSW 9 69483821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGAATCTGGTGATGTGAAAA -3'
(R):5'- GCGAACTTGTCTCTGACTAAAATAT -3'

Sequencing Primer
(F):5'- GAATCTGGTGATGTGAAAAAGAAAAG -3'
(R):5'- AAGTGTGTGCTTGAAACCCC -3'
Posted On2014-06-23