Incidental Mutation 'R1828:Gaa'
ID207032
Institutional Source Beutler Lab
Gene Symbol Gaa
Ensembl Gene ENSMUSG00000025579
Gene Nameglucosidase, alpha, acid
SynonymsE430018M07Rik
MMRRC Submission 039855-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R1828 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119267887-119285454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119283272 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 763 (V763A)
Ref Sequence ENSEMBL: ENSMUSP00000101866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000106259] [ENSMUST00000132706]
Predicted Effect probably damaging
Transcript: ENSMUST00000026666
AA Change: V763A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579
AA Change: V763A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106259
AA Change: V763A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579
AA Change: V763A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132706
SMART Domains Protein: ENSMUSP00000119702
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 46 269 2.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138510
Predicted Effect probably benign
Transcript: ENSMUST00000143288
SMART Domains Protein: ENSMUSP00000121984
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 8 207 2.2e-67 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysosomal acid glucosidase that is involved in the degradation of glycogen. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that cleaves alpha-1-4 and alpha-1-6 glycosidic bonds of glycogen, maltose and intermediate oligosaccharides within the lysosome. Mice lacking the encoded protein exhibit symptoms similar to human Pompe syndrome such as accumulation of glycogen in cardiac and skeletal muscle lysosomes resulting in reduced mobility and strength. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to massive glycogen accumulation in multiple organs, cardiomyopathy, hypoactivity, severe motor disability, profound muscle weakness and wasting, and progressive kyphosis. The age of onset and clinical course ofthe disease appear to be strain-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Gaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Gaa APN 11 119274960 missense probably benign
IGL00780:Gaa APN 11 119274291 unclassified probably null
IGL00975:Gaa APN 11 119274683 missense possibly damaging 0.93
IGL01354:Gaa APN 11 119270568 missense probably benign 0.18
IGL01572:Gaa APN 11 119284177 missense probably benign
IGL01634:Gaa APN 11 119274076 missense possibly damaging 0.79
IGL01724:Gaa APN 11 119275121 missense possibly damaging 0.65
IGL01889:Gaa APN 11 119278297 missense probably benign 0.03
IGL02052:Gaa APN 11 119284195 missense possibly damaging 0.76
IGL02173:Gaa APN 11 119274913 missense probably damaging 1.00
IGL02261:Gaa APN 11 119281265 makesense probably null
IGL02337:Gaa APN 11 119277603 missense probably damaging 1.00
IGL02625:Gaa APN 11 119274733 missense probably damaging 1.00
IGL02818:Gaa APN 11 119276848 missense probably damaging 0.97
R0135:Gaa UTSW 11 119278890 missense probably benign 0.00
R0280:Gaa UTSW 11 119284547 missense probably damaging 1.00
R0479:Gaa UTSW 11 119281236 missense possibly damaging 0.95
R1130:Gaa UTSW 11 119274683 missense probably damaging 0.97
R1132:Gaa UTSW 11 119285059 missense probably damaging 0.99
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1179:Gaa UTSW 11 119281128 missense probably damaging 0.98
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1475:Gaa UTSW 11 119274316 splice site probably null
R1711:Gaa UTSW 11 119280460 missense probably damaging 1.00
R1817:Gaa UTSW 11 119284498 nonsense probably null
R2013:Gaa UTSW 11 119284583 unclassified probably null
R2126:Gaa UTSW 11 119270282 nonsense probably null
R2179:Gaa UTSW 11 119275058 critical splice acceptor site probably null
R2496:Gaa UTSW 11 119283705 missense possibly damaging 0.53
R2936:Gaa UTSW 11 119283724 missense probably benign 0.02
R4321:Gaa UTSW 11 119270137 missense probably benign 0.20
R4603:Gaa UTSW 11 119278958 missense probably damaging 1.00
R4849:Gaa UTSW 11 119272987 missense possibly damaging 0.95
R5225:Gaa UTSW 11 119276843 missense probably damaging 1.00
R5643:Gaa UTSW 11 119280535 missense possibly damaging 0.96
R5644:Gaa UTSW 11 119280535 missense possibly damaging 0.96
R6074:Gaa UTSW 11 119284186 missense probably benign 0.07
R6154:Gaa UTSW 11 119278352 missense probably damaging 1.00
R6208:Gaa UTSW 11 119281171 missense probably benign 0.01
R6209:Gaa UTSW 11 119281171 missense probably benign 0.01
R6258:Gaa UTSW 11 119281171 missense probably benign 0.01
R6259:Gaa UTSW 11 119281171 missense probably benign 0.01
R6260:Gaa UTSW 11 119281171 missense probably benign 0.01
X0064:Gaa UTSW 11 119274015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTGCTCTGTGCTCTGGC -3'
(R):5'- TGGAAGCTACCTACTCCAGAC -3'

Sequencing Primer
(F):5'- TGGCACAAGTGTCTTAGATCC -3'
(R):5'- AAGCTACCTACTCCAGACTTAATTTC -3'
Posted On2014-06-23