Incidental Mutation 'R1828:Erbin'
ID207036
Institutional Source Beutler Lab
Gene Symbol Erbin
Ensembl Gene ENSMUSG00000021709
Gene NameErbb2 interacting protein
Synonyms1700028E05Rik, Erbb2ip, Erbin
MMRRC Submission 039855-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1828 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location103818787-103920514 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 103860069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022222] [ENSMUST00000053927] [ENSMUST00000091269] [ENSMUST00000169083] [ENSMUST00000188997] [ENSMUST00000191275]
Predicted Effect probably null
Transcript: ENSMUST00000022222
SMART Domains Protein: ENSMUSP00000022222
Gene: ENSMUSG00000021709

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1294 1374 3.6e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000053927
SMART Domains Protein: ENSMUSP00000057956
Gene: ENSMUSG00000021709

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091269
SMART Domains Protein: ENSMUSP00000088813
Gene: ENSMUSG00000021709

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1320 1400 3.6e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169083
SMART Domains Protein: ENSMUSP00000127607
Gene: ENSMUSG00000021709

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1329 1409 3.6e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188997
SMART Domains Protein: ENSMUSP00000140931
Gene: ENSMUSG00000021709

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1212 1292 3.6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189323
Predicted Effect probably null
Transcript: ENSMUST00000191275
SMART Domains Protein: ENSMUSP00000140536
Gene: ENSMUSG00000021709

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat and PDZ domain (LAP) family. The encoded protein contains 17 leucine-rich repeats and one PDZ domain. It binds to the unphosphorylated form of the ERBB2 protein and regulates ERBB2 function and localization. It has also been shown to affect the Ras signaling pathway by disrupting Ras-Raf interaction. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null or gene trapped allele exhibit impaired myelination, reduced nerve conduction, and hyporesponsiveness to tactile stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Erbin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Erbin APN 13 103834012 missense probably damaging 1.00
IGL01404:Erbin APN 13 103839464 missense probably damaging 1.00
IGL01455:Erbin APN 13 103859387 missense probably damaging 1.00
IGL01871:Erbin APN 13 103834766 missense probably damaging 0.98
IGL01930:Erbin APN 13 103841172 missense probably damaging 1.00
IGL02112:Erbin APN 13 103862336 missense probably benign 0.12
IGL02736:Erbin APN 13 103839395 missense probably damaging 1.00
IGL03149:Erbin APN 13 103841163 missense possibly damaging 0.82
IGL03169:Erbin APN 13 103841232 missense possibly damaging 0.93
IGL02802:Erbin UTSW 13 103868130 missense probably damaging 1.00
PIT1430001:Erbin UTSW 13 103859509 missense probably damaging 1.00
R0329:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0330:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0492:Erbin UTSW 13 103834358 missense probably damaging 0.98
R0508:Erbin UTSW 13 103834027 missense probably damaging 1.00
R0589:Erbin UTSW 13 103886287 missense probably damaging 1.00
R1103:Erbin UTSW 13 103886202 missense probably benign 0.00
R1139:Erbin UTSW 13 103884253 missense probably damaging 1.00
R1316:Erbin UTSW 13 103841234 missense possibly damaging 0.94
R1675:Erbin UTSW 13 103841178 missense probably damaging 1.00
R1698:Erbin UTSW 13 103833731 missense possibly damaging 0.91
R1727:Erbin UTSW 13 103827968 missense probably benign 0.01
R1745:Erbin UTSW 13 103839449 missense probably damaging 1.00
R1746:Erbin UTSW 13 103850831 missense probably damaging 1.00
R1764:Erbin UTSW 13 103843451 splice site probably benign
R1840:Erbin UTSW 13 103834947 missense probably benign 0.01
R1987:Erbin UTSW 13 103886203 missense probably benign 0.36
R1992:Erbin UTSW 13 103833713 missense probably benign 0.33
R2013:Erbin UTSW 13 103857533 missense probably damaging 1.00
R2025:Erbin UTSW 13 103830195 missense probably benign 0.01
R2056:Erbin UTSW 13 103830316 missense probably benign 0.27
R2171:Erbin UTSW 13 103834958 missense probably benign 0.00
R2366:Erbin UTSW 13 103844909 missense probably damaging 1.00
R2897:Erbin UTSW 13 103886197 missense probably damaging 1.00
R3912:Erbin UTSW 13 103862287 missense probably benign 0.35
R3912:Erbin UTSW 13 103886338 splice site probably benign
R4073:Erbin UTSW 13 103860111 missense probably damaging 1.00
R4458:Erbin UTSW 13 103833557 missense probably damaging 1.00
R4465:Erbin UTSW 13 103844885 missense probably benign 0.05
R4525:Erbin UTSW 13 103857092 missense probably benign
R4780:Erbin UTSW 13 103884206 missense probably damaging 1.00
R4877:Erbin UTSW 13 103850838 missense probably damaging 0.99
R4879:Erbin UTSW 13 103834774 missense probably benign 0.05
R5396:Erbin UTSW 13 103857409 critical splice donor site probably null
R5898:Erbin UTSW 13 103839305 critical splice donor site probably null
R5955:Erbin UTSW 13 103830192 missense probably benign 0.40
R6073:Erbin UTSW 13 103844921 nonsense probably null
R6107:Erbin UTSW 13 103833892 missense probably benign 0.06
R6257:Erbin UTSW 13 103862288 missense probably benign 0.35
R6294:Erbin UTSW 13 103857056 missense probably benign 0.36
R6358:Erbin UTSW 13 103845565 missense probably damaging 1.00
R6476:Erbin UTSW 13 103841247 missense probably damaging 1.00
R6485:Erbin UTSW 13 103868113 missense probably damaging 1.00
R6631:Erbin UTSW 13 103824892 missense probably benign 0.02
R6735:Erbin UTSW 13 103884210 missense probably damaging 1.00
R6736:Erbin UTSW 13 103834766 missense possibly damaging 0.72
R6749:Erbin UTSW 13 103834377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCTTTAGATATGAGAGCATG -3'
(R):5'- GTAGTTGCGTACACCTTGGC -3'

Sequencing Primer
(F):5'- ACTGAATTGGTACTAATAGAAATGCG -3'
(R):5'- TACACCTTGGCAGGGCTTC -3'
Posted On2014-06-23