Incidental Mutation 'R1828:Anxa7'
ID207039
Institutional Source Beutler Lab
Gene Symbol Anxa7
Ensembl Gene ENSMUSG00000021814
Gene Nameannexin A7
Synonymssynexin, Anx7
MMRRC Submission 039855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1828 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20455260-20480133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20462664 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 267 (I267N)
Ref Sequence ENSEMBL: ENSMUSP00000153669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065504] [ENSMUST00000100844] [ENSMUST00000224975] [ENSMUST00000225941]
Predicted Effect probably damaging
Transcript: ENSMUST00000065504
AA Change: I267N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066035
Gene: ENSMUSG00000021814
AA Change: I267N

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100844
AA Change: I289N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098405
Gene: ENSMUSG00000021814
AA Change: I289N

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224410
Predicted Effect probably damaging
Transcript: ENSMUST00000224975
AA Change: I267N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225118
Predicted Effect probably benign
Transcript: ENSMUST00000225941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226001
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VII is a member of the annexin family of calcium-dependent phospholipid binding proteins.The Annexin VII gene contains 14 exons and spans approximately 34 kb of DNA. An alternatively spliced cassette exon results in two mRNA transcripts of 2.0 and 2.4 kb which are predicted to generate two protein isoforms differing in their N-terminal domain. The alternative splicing event is tissue specific and the mRNA containing the cassette exon is prevalent in brain, heart and skeletal muscle. The transcripts also differ in their 3'-non coding regions by the use of two alternative poly(A) signals. Annexin VII encodes a protein with a molecular weight of approximately 51 kDa with a unique, highly hydrophobic N-terminal domain of 167 amino acids and a conserved C-terminal region of 299 amino acids. The latter domain is composed of alternating hydrophobic and hydrophilic segments. Structural analysis of the protein suggests that Annexin VII is a membrane binding protein with diverse properties, including voltage-sensitive calcium channel activity, ion selectivity and membrane fusion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are viable but exhibit altered Ca2+ signaling and/or homeostasis in cardiomyocytes and glia cells, and changes in erythrocyte shape, osmotic resistance, platelet number and aggregation velocity. Homozygotes for another null allele die at ~E10 with cerebral hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Anxa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Anxa7 APN 14 20458681 missense possibly damaging 0.87
IGL01137:Anxa7 APN 14 20456580 nonsense probably null
IGL01376:Anxa7 APN 14 20460456 missense probably benign 0.00
IGL01651:Anxa7 APN 14 20456501 missense probably damaging 1.00
IGL02830:Anxa7 APN 14 20456540 missense possibly damaging 0.67
IGL03078:Anxa7 APN 14 20456556 missense probably damaging 0.97
IGL03177:Anxa7 APN 14 20456586 missense probably benign 0.41
FR4449:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4548:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4737:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4976:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
LCD18:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0121:Anxa7 UTSW 14 20460159 missense probably damaging 0.97
R0329:Anxa7 UTSW 14 20469498 splice site probably null
R0330:Anxa7 UTSW 14 20469498 splice site probably null
R1416:Anxa7 UTSW 14 20462707 missense probably damaging 1.00
R1601:Anxa7 UTSW 14 20464615 nonsense probably null
R1701:Anxa7 UTSW 14 20460161 missense probably damaging 1.00
R1794:Anxa7 UTSW 14 20471467 missense unknown
R4676:Anxa7 UTSW 14 20467915 missense probably benign 0.00
R5354:Anxa7 UTSW 14 20464909 missense possibly damaging 0.63
R6547:Anxa7 UTSW 14 20469393 missense probably benign 0.13
R6985:Anxa7 UTSW 14 20471568 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTAGAAGAAATCTGTCCACTGC -3'
(R):5'- ACTTGCAGTGATGGATGAGGC -3'

Sequencing Primer
(F):5'- TGTGTTGTTCCACAAAGACACC -3'
(R):5'- AGGCACAGTGACTTGGTATC -3'
Posted On2014-06-23