Incidental Mutation 'R1828:Kcnma1'
ID207040
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Namepotassium large conductance calcium-activated channel, subfamily M, alpha member 1
SynonymsmSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo
MMRRC Submission 039855-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R1828 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location23289431-24014491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23330929 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 903 (D903Y)
Ref Sequence ENSEMBL: ENSMUSP00000152959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000100831] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000163322] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000179836] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000223749] [ENSMUST00000224077] [ENSMUST00000224232] [ENSMUST00000224285] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000224812] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225471] [ENSMUST00000225556] [ENSMUST00000225794]
Predicted Effect probably damaging
Transcript: ENSMUST00000065788
AA Change: D840Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: D840Y

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 835 843 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 1005 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074983
AA Change: D899Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142
AA Change: D899Y

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 894 902 N/A INTRINSIC
low complexity region 950 961 N/A INTRINSIC
low complexity region 1064 1090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100831
AA Change: D870Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098393
Gene: ENSMUSG00000063142
AA Change: D870Y

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.1e-18 PFAM
Pfam:Ion_trans_2 180 268 5.5e-16 PFAM
Pfam:TrkA_N 314 413 7.3e-7 PFAM
Pfam:BK_channel_a 411 509 6.2e-31 PFAM
low complexity region 865 873 N/A INTRINSIC
low complexity region 921 932 N/A INTRINSIC
low complexity region 1035 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112423
AA Change: D786Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142
AA Change: D786Y

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:Ion_trans 37 208 2.1e-18 PFAM
Pfam:Ion_trans_2 126 214 5.3e-16 PFAM
Pfam:TrkA_N 260 359 7e-7 PFAM
Pfam:BK_channel_a 357 455 6e-31 PFAM
low complexity region 781 789 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 951 977 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145596
AA Change: D993Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000163322
AA Change: D837Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128553
Gene: ENSMUSG00000063142
AA Change: D837Y

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 3.2e-18 PFAM
Pfam:Ion_trans_2 180 268 1.1e-15 PFAM
Pfam:TrkA_N 314 413 7e-7 PFAM
Pfam:BK_channel_a 411 509 6e-31 PFAM
low complexity region 832 840 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 1002 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172099
AA Change: D902Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142
AA Change: D902Y

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.6e-7 PFAM
Pfam:BK_channel_a 411 509 6.5e-31 PFAM
low complexity region 897 905 N/A INTRINSIC
low complexity region 953 964 N/A INTRINSIC
low complexity region 1067 1093 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177634
AA Change: D867Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: D867Y

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Ion_trans 53 272 4.9e-19 PFAM
Pfam:Ion_trans_2 180 267 1.2e-15 PFAM
Pfam:BK_channel_a 413 508 1.2e-35 PFAM
low complexity region 862 870 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1032 1058 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179097
AA Change: D864Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: D864Y

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.6e-18 PFAM
Pfam:Ion_trans_2 180 268 1e-15 PFAM
Pfam:TrkA_N 314 413 1.1e-7 PFAM
Pfam:BK_channel_a 411 509 3.2e-31 PFAM
low complexity region 859 867 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1029 1055 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179836
AA Change: D843Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142
AA Change: D843Y

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.2e-18 PFAM
Pfam:Ion_trans_2 180 268 9.5e-16 PFAM
Pfam:BK_channel_a 389 457 2.4e-15 PFAM
low complexity region 838 846 N/A INTRINSIC
low complexity region 894 905 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188210
AA Change: D924Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: D924Y

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188285
AA Change: D1024Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142
AA Change: D1024Y

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188991
AA Change: D1020Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142
AA Change: D1020Y

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190044
AA Change: D962Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142
AA Change: D962Y

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190985
Predicted Effect probably damaging
Transcript: ENSMUST00000223655
AA Change: D959Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223727
AA Change: D897Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223749
AA Change: D897Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224025
AA Change: D915Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224077
AA Change: D962Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224232
AA Change: D955Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224285
AA Change: D897Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224468
AA Change: D1027Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224787
AA Change: D846Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224812
AA Change: D930Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225315
AA Change: D926Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225431
AA Change: D897Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225471
AA Change: D926Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225556
AA Change: D903Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225794
Meta Mutation Damage Score 0.5 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23314322 splice site probably benign
IGL01520:Kcnma1 APN 14 23501143 missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23530299 splice site probably benign
IGL02140:Kcnma1 APN 14 23309045 missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23336967 missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23526813 missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23543076 missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23311689 missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23386259 critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23363832 missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23463156 missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23309154 missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0115:Kcnma1 UTSW 14 23314175 missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23803166 missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23508052 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23373197 missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23311716 missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23509784 splice site probably benign
R0668:Kcnma1 UTSW 14 23367495 missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23494607 missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23367642 missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23311724 missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23463200 missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23314194 missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1864:Kcnma1 UTSW 14 23803162 missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23337029 missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23314220 missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23543083 nonsense probably null
R2866:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23299938 missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23505255 missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23311652 missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23337029 missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23309038 critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23803202 missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23363836 missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23309152 missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24004118 intron probably benign
R5175:Kcnma1 UTSW 14 23336038 critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23463185 missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23528404 nonsense probably null
R5705:Kcnma1 UTSW 14 24003771 missense possibly damaging 0.73
R5746:Kcnma1 UTSW 14 23494567 missense probably damaging 1.00
R5780:Kcnma1 UTSW 14 23386351 nonsense probably null
R5793:Kcnma1 UTSW 14 23309035 splice site probably null
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24003868 missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23509889 missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23336097 missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24002814 nonsense probably null
R6822:Kcnma1 UTSW 14 24003744 splice site probably null
R6855:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23526534 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCACAGTTCAAGTTCCTGC -3'
(R):5'- CCACTTGATCCCAGTGCTTG -3'

Sequencing Primer
(F):5'- ACAGTTCAAGTTCCTGCCAGTATC -3'
(R):5'- GGGATCCATCAATAGCTTCCTCATG -3'
Posted On2014-06-23