Incidental Mutation 'R1828:Hrg'
ID207049
Institutional Source Beutler Lab
Gene Symbol Hrg
Ensembl Gene ENSMUSG00000022877
Gene Namehistidine-rich glycoprotein
SynonymsD18020, D16JH2
MMRRC Submission 039855-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R1828 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22951072-22961656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 22956103 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 161 (E161A)
Ref Sequence ENSEMBL: ENSMUSP00000023590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023590] [ENSMUST00000232422]
Predicted Effect probably damaging
Transcript: ENSMUST00000023590
AA Change: E161A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023590
Gene: ENSMUSG00000022877
AA Change: E161A

DomainStartEndE-ValueType
CY 22 133 8.98e-4 SMART
CY 146 251 1.3e-2 SMART
low complexity region 347 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232422
AA Change: E161A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild monocytosis, decreased bleeding time, faster clot lysis, and abnormal blood coagulation; however, wound healing is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Hrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Hrg APN 16 22959159 critical splice acceptor site probably null
IGL02795:Hrg APN 16 22957553 unclassified probably benign
R0042:Hrg UTSW 16 22961136 unclassified probably benign
R0184:Hrg UTSW 16 22953771 critical splice donor site probably null
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1733:Hrg UTSW 16 22951247 missense probably damaging 1.00
R1919:Hrg UTSW 16 22954457 missense probably damaging 1.00
R2104:Hrg UTSW 16 22956199 missense probably benign 0.09
R2281:Hrg UTSW 16 22961309 unclassified probably benign
R2447:Hrg UTSW 16 22961148 unclassified probably benign
R3962:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R3963:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R4571:Hrg UTSW 16 22961222 unclassified probably benign
R4903:Hrg UTSW 16 22961151 unclassified probably benign
R4904:Hrg UTSW 16 22951250 missense probably benign 0.03
R5236:Hrg UTSW 16 22961513 unclassified probably benign
R6020:Hrg UTSW 16 22954518 missense probably damaging 1.00
R6054:Hrg UTSW 16 22953662 missense probably benign 0.05
R6207:Hrg UTSW 16 22954538 critical splice donor site probably null
R6374:Hrg UTSW 16 22960992 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTAATAACAGCGTCCCTCTCCG -3'
(R):5'- CACTAAGCATCAAAGGCTGC -3'

Sequencing Primer
(F):5'- CTCCGGGCTGTGCTTACATG -3'
(R):5'- CTGCCCAAGTGAGACAGGTGTAC -3'
Posted On2014-06-23