Incidental Mutation 'R1828:Cyp4f14'
ID207051
Institutional Source Beutler Lab
Gene Symbol Cyp4f14
Ensembl Gene ENSMUSG00000024292
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 14
Synonymsleukotriene B4 omega hydroxylase, 1300014O15Rik
MMRRC Submission 039855-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1828 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32905071-32917342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32911235 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 190 (D190A)
Ref Sequence ENSEMBL: ENSMUSP00000136139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054174] [ENSMUST00000179434]
Predicted Effect probably damaging
Transcript: ENSMUST00000054174
AA Change: D190A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050478
Gene: ENSMUSG00000024292
AA Change: D190A

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179434
AA Change: D190A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136139
Gene: ENSMUSG00000024292
AA Change: D190A

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein likely localizes to the endoplasmic reticulum. When expressed in yeast the enzyme is capable of oxdizing arachidonic acid. It can also catalyze the epoxidation of 22:6n-3 and 22:5n-3 polyunsaturated long-chain fatty acids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced vitamin E-omega-hydroxylase activity and altered levels of tocopherols and their metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pcdhb2 T A 18: 37,295,985 V337D probably damaging Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Cyp4f14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Cyp4f14 APN 17 32914566 missense probably benign 0.06
IGL00858:Cyp4f14 APN 17 32911718 splice site probably benign
IGL01673:Cyp4f14 APN 17 32911151 splice site probably null
IGL01716:Cyp4f14 APN 17 32905496 utr 3 prime probably benign
IGL01768:Cyp4f14 APN 17 32908002 missense probably damaging 1.00
IGL02314:Cyp4f14 APN 17 32906291 missense probably benign 0.12
IGL02697:Cyp4f14 APN 17 32905623 missense probably damaging 0.97
IGL03035:Cyp4f14 APN 17 32914634 missense probably benign 0.15
R1186:Cyp4f14 UTSW 17 32916786 missense probably benign
R1230:Cyp4f14 UTSW 17 32916788 missense probably benign 0.00
R1671:Cyp4f14 UTSW 17 32916909 intron probably benign
R1672:Cyp4f14 UTSW 17 32909236 missense probably benign 0.00
R1696:Cyp4f14 UTSW 17 32909171 missense possibly damaging 0.81
R1934:Cyp4f14 UTSW 17 32906315 missense probably damaging 1.00
R2023:Cyp4f14 UTSW 17 32906531 missense probably damaging 1.00
R3013:Cyp4f14 UTSW 17 32909165 missense probably benign 0.01
R3783:Cyp4f14 UTSW 17 32916762 missense probably benign 0.00
R4013:Cyp4f14 UTSW 17 32916879 nonsense probably null
R4369:Cyp4f14 UTSW 17 32909258 missense probably benign
R4371:Cyp4f14 UTSW 17 32909258 missense probably benign
R4683:Cyp4f14 UTSW 17 32908011 missense probably null 0.78
R5282:Cyp4f14 UTSW 17 32907985 missense probably damaging 0.99
R5332:Cyp4f14 UTSW 17 32906091 missense probably benign 0.00
R5810:Cyp4f14 UTSW 17 32906098 missense possibly damaging 0.88
R6244:Cyp4f14 UTSW 17 32906317 missense probably benign 0.41
R6622:Cyp4f14 UTSW 17 32914645 missense probably benign
R6972:Cyp4f14 UTSW 17 32905509 missense probably benign 0.00
R6975:Cyp4f14 UTSW 17 32914634 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTGCTGATCCCTTCAAGC -3'
(R):5'- GCACGTGAGTTTCTGGAACAC -3'

Sequencing Primer
(F):5'- TCAAGCTTGTTTCTAATGTGCC -3'
(R):5'- GGAACACAGGGTTACAACTCTTTC -3'
Posted On2014-06-23