Incidental Mutation 'R1828:Pcdhb2'
ID207056
Institutional Source Beutler Lab
Gene Symbol Pcdhb2
Ensembl Gene ENSMUSG00000051599
Gene Nameprotocadherin beta 2
SynonymsPcdhbB
MMRRC Submission 039855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1828 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37294812-37297624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37295985 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 337 (V337D)
Ref Sequence ENSEMBL: ENSMUSP00000057921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000193137] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056522
AA Change: V337D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599
AA Change: V337D

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193137
SMART Domains Protein: ENSMUSP00000141439
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
CA 13 94 1.8e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T C 17: 40,880,071 T156A probably benign Het
9230106D20Rik A T 10: 19,660,317 noncoding transcript Het
Abca3 A G 17: 24,366,197 D144G probably benign Het
Anxa2 T A 9: 69,482,978 L121Q probably damaging Het
Anxa7 A T 14: 20,462,664 I267N probably damaging Het
Asb14 A T 14: 26,911,840 D334V possibly damaging Het
Batf3 A G 1: 191,098,517 N20S probably benign Het
BC067074 T A 13: 113,368,808 L2157Q probably damaging Het
Bub1b A G 2: 118,638,439 H895R probably benign Het
C1qtnf12 G A 4: 155,965,703 probably null Het
Cars T C 7: 143,576,648 I294V probably damaging Het
Ccdc142 G A 6: 83,107,481 A527T probably damaging Het
Ccdc92 T C 5: 124,836,178 N96D probably benign Het
Ceacam18 T A 7: 43,639,456 D210E probably benign Het
Cenpe A G 3: 135,246,496 T1373A probably damaging Het
Cfap161 T G 7: 83,791,724 probably null Het
Cldn19 A G 4: 119,255,793 D74G probably benign Het
Clec12a A G 6: 129,353,799 T115A probably damaging Het
Cox7a2l T A 17: 83,503,968 Q78L probably benign Het
Crot T C 5: 8,969,080 N491S probably benign Het
Ctr9 A G 7: 111,043,958 probably null Het
Cyp4f14 T G 17: 32,911,235 D190A probably damaging Het
D630039A03Rik C T 4: 57,910,240 V191I probably benign Het
Dnah10 A T 5: 124,761,279 N1124I probably benign Het
Duox1 T A 2: 122,347,380 Y1548* probably null Het
E430018J23Rik T A 7: 127,391,909 H302L probably damaging Het
Epdr1 G A 13: 19,594,603 Q6* probably null Het
Erbin A G 13: 103,860,069 probably null Het
Ero1l A T 14: 45,287,760 I436K probably damaging Het
Exph5 A T 9: 53,376,641 Q1674L possibly damaging Het
Fat4 A T 3: 38,983,458 Y3753F probably damaging Het
Gaa T C 11: 119,283,272 V763A probably damaging Het
Gm8251 A T 1: 44,057,074 N1621K possibly damaging Het
Golim4 G A 3: 75,902,438 T216I probably damaging Het
Gpr83 G T 9: 14,868,333 C269F possibly damaging Het
Gtf2f2 A G 14: 76,007,703 probably null Het
Gtf3c5 T C 2: 28,579,682 Y70C probably damaging Het
Hao1 T A 2: 134,530,664 R141S probably benign Het
Hecw2 T C 1: 53,926,023 D548G probably benign Het
Hr G A 14: 70,572,037 probably null Het
Hrg A C 16: 22,956,103 E161A probably damaging Het
Hydin A T 8: 110,510,894 N1933I probably benign Het
Itpr2 A G 6: 146,328,332 L1255P probably damaging Het
Kcnma1 C A 14: 23,330,929 D903Y probably damaging Het
Kif5c T C 2: 49,680,240 probably null Het
Mgat5b C A 11: 116,977,788 H512Q probably damaging Het
Mtmr4 T C 11: 87,612,117 V999A probably benign Het
Mttp G T 3: 138,107,280 Q545K probably damaging Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nexn A G 3: 152,242,768 I386T probably damaging Het
Nrip3 A G 7: 109,766,556 S85P probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1202 A T 2: 88,818,058 I296F probably benign Het
Olfr126 C T 17: 37,851,075 A161V probably benign Het
Olfr32 A G 2: 90,138,587 L184S probably damaging Het
Olfr508 G T 7: 108,630,648 V219F possibly damaging Het
Olfr543 A G 7: 102,477,513 L119P probably damaging Het
Olr1 T C 6: 129,488,932 N37S possibly damaging Het
Pax4 T C 6: 28,443,447 Y290C probably benign Het
Pglyrp4 T C 3: 90,733,003 Y187H probably damaging Het
Pi4ka A G 16: 17,280,750 M2017T probably benign Het
Pkdrej T C 15: 85,819,282 T818A possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Pygm T C 19: 6,397,607 I648T possibly damaging Het
Rab4a A T 8: 123,823,826 K15I probably damaging Het
Rasa3 T C 8: 13,585,035 E428G probably benign Het
Rnf182 G A 13: 43,668,534 W187* probably null Het
Rpl3 C T 15: 80,080,390 V222M possibly damaging Het
Rtl9 C T X: 143,103,015 S1141F possibly damaging Het
S100a11 A T 3: 93,526,121 I91F probably benign Het
Sfswap C T 5: 129,513,084 T215I probably damaging Het
Slit2 A G 5: 48,304,030 D1456G probably damaging Het
Tex19.2 C T 11: 121,117,491 V44I probably benign Het
Tex33 T C 15: 78,386,388 Y60C possibly damaging Het
Tmem127 G A 2: 127,256,174 probably null Het
Tpd52 G T 3: 8,947,519 N59K probably damaging Het
Trpc3 G A 3: 36,638,546 P766S possibly damaging Het
Usp17la T A 7: 104,861,124 V312D probably damaging Het
Xirp2 A G 2: 67,515,238 N2608D possibly damaging Het
Zscan25 C A 5: 145,291,048 H507Q possibly damaging Het
Other mutations in Pcdhb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Pcdhb2 APN 18 37296463 unclassified probably null
IGL01538:Pcdhb2 APN 18 37295322 nonsense probably null
IGL01716:Pcdhb2 APN 18 37296738 missense probably damaging 0.99
IGL01747:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01770:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01999:Pcdhb2 APN 18 37296837 missense probably damaging 1.00
IGL02174:Pcdhb2 APN 18 37296498 missense probably damaging 1.00
IGL02325:Pcdhb2 APN 18 37296680 missense possibly damaging 0.91
IGL03148:Pcdhb2 APN 18 37296778 missense probably damaging 1.00
IGL03263:Pcdhb2 APN 18 37296006 missense probably damaging 1.00
R0158:Pcdhb2 UTSW 18 37297230 missense probably damaging 1.00
R0512:Pcdhb2 UTSW 18 37295979 missense probably damaging 1.00
R0656:Pcdhb2 UTSW 18 37295490 missense probably damaging 1.00
R0670:Pcdhb2 UTSW 18 37296648 missense probably damaging 1.00
R0698:Pcdhb2 UTSW 18 37297366 missense probably benign 0.00
R0825:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0827:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0862:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0863:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1344:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1440:Pcdhb2 UTSW 18 37296290 missense probably benign 0.22
R1826:Pcdhb2 UTSW 18 37295985 missense probably damaging 0.99
R1869:Pcdhb2 UTSW 18 37297355 unclassified probably null
R1871:Pcdhb2 UTSW 18 37297355 unclassified probably null
R2292:Pcdhb2 UTSW 18 37297244 unclassified probably null
R3743:Pcdhb2 UTSW 18 37296417 missense probably damaging 1.00
R4067:Pcdhb2 UTSW 18 37297314 unclassified probably null
R4127:Pcdhb2 UTSW 18 37295541 missense probably damaging 0.97
R4402:Pcdhb2 UTSW 18 37295402 missense probably benign 0.05
R4579:Pcdhb2 UTSW 18 37296115 missense probably damaging 1.00
R4621:Pcdhb2 UTSW 18 37295927 missense probably benign 0.44
R4678:Pcdhb2 UTSW 18 37296207 missense probably damaging 1.00
R5143:Pcdhb2 UTSW 18 37296732 missense probably damaging 1.00
R5152:Pcdhb2 UTSW 18 37296126 missense probably damaging 0.97
R6552:Pcdhb2 UTSW 18 37295993 missense probably benign
R6908:Pcdhb2 UTSW 18 37296524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTACGCCTTTTCCCAAG -3'
(R):5'- TGATCTGGTCTCTCGATCCAG -3'

Sequencing Primer
(F):5'- AAGCCTCTGAAGACATTCGG -3'
(R):5'- TCTCTCGATCCAGGGCTGTG -3'
Posted On2014-06-23