Incidental Mutation 'R1830:Lrriq1'
ID207250
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 039857-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1830 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 103161759 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 1332 (T1332P)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
Predicted Effect probably benign
Transcript: ENSMUST00000166240
AA Change: T1332P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: T1332P

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,946,717 D532G possibly damaging Het
Abca13 T C 11: 9,290,350 S738P probably benign Het
Abi3bp C A 16: 56,587,985 P261Q probably damaging Het
Adam19 A G 11: 46,127,278 N389S probably damaging Het
Adgrv1 A T 13: 81,489,077 V3415D possibly damaging Het
Ankrd33 A T 15: 101,119,551 I282F probably damaging Het
Arhgap39 C T 15: 76,735,183 V734M probably damaging Het
Arsg T C 11: 109,563,274 probably null Het
Atp8b4 C T 2: 126,403,381 G283R probably benign Het
B3galnt2 T G 13: 13,991,534 L338* probably null Het
C87414 A T 5: 93,637,686 I245K probably benign Het
Cdc14a A T 3: 116,422,647 Y1* probably null Het
Ceacam16 T C 7: 19,858,878 E35G possibly damaging Het
Cfap46 T A 7: 139,640,407 D1244V possibly damaging Het
Chordc1 T C 9: 18,311,978 Y245H probably damaging Het
Col6a6 C A 9: 105,702,270 V1919F probably damaging Het
Colgalt1 T C 8: 71,623,137 V476A probably damaging Het
Cped1 T C 6: 22,237,728 C948R probably damaging Het
Cyfip2 T C 11: 46,199,019 D1189G probably damaging Het
Cyp27b1 T C 10: 127,049,083 Y72H possibly damaging Het
Dagla A G 19: 10,271,014 M94T probably benign Het
Dip2a A G 10: 76,317,963 S178P probably damaging Het
Dlec1 T C 9: 119,138,790 V1220A probably benign Het
Dpysl2 T C 14: 66,868,391 probably benign Het
E2f6 T C 12: 16,818,883 V69A probably benign Het
Fat3 T C 9: 15,915,340 T4439A probably benign Het
Fn1 T C 1: 71,624,259 I1023M probably damaging Het
Gabrr2 G A 4: 33,077,481 V83M probably damaging Het
Gfral T C 9: 76,193,203 N318D probably benign Het
Gm5611 A T 9: 17,030,777 noncoding transcript Het
Gpat3 A T 5: 100,893,180 M369L probably benign Het
Grik5 T C 7: 25,046,301 D449G possibly damaging Het
Gucy2g T A 19: 55,222,930 T623S possibly damaging Het
H2-T22 T C 17: 36,041,542 T164A probably benign Het
Herc1 T A 9: 66,497,599 C4484S possibly damaging Het
Hira T C 16: 18,947,414 S659P probably damaging Het
Hoxa7 T C 6: 52,217,327 T27A possibly damaging Het
Hoxd1 T C 2: 74,763,522 S141P probably damaging Het
Kank1 C A 19: 25,411,032 Q690K probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif1bp T C 10: 62,559,327 Y512C probably damaging Het
Lepr A C 4: 101,735,677 Y163S probably damaging Het
Leprotl1 T C 8: 34,140,768 I29V probably benign Het
Mrps15 A G 4: 126,055,407 K223E probably damaging Het
Mrps7 T A 11: 115,606,985 N225K probably benign Het
Nav3 T A 10: 109,823,323 D811V probably damaging Het
Ndst3 T A 3: 123,548,938 R741S probably damaging Het
Nos3 T C 5: 24,370,133 Y356H probably damaging Het
Nxpe3 A G 16: 55,866,081 V188A probably damaging Het
Olfr1057 T C 2: 86,375,143 K90E possibly damaging Het
Olfr469 T A 7: 107,823,371 I33F probably benign Het
Olfr702 T C 7: 106,824,110 R139G probably benign Het
Pdia4 A T 6: 47,796,761 C551* probably null Het
Pex13 A G 11: 23,655,513 F239S probably damaging Het
Pigq A G 17: 25,935,006 M273T probably benign Het
Plppr2 C T 9: 21,947,751 P388L probably damaging Het
Polr3b C T 10: 84,692,922 Q737* probably null Het
Ppfibp1 T C 6: 147,022,259 probably null Het
Ppfibp2 C A 7: 107,637,297 D17E probably damaging Het
Ptpn13 A G 5: 103,543,459 D1064G probably benign Het
Qtrt2 A T 16: 43,871,655 S168T probably damaging Het
Rbp3 T C 14: 33,954,644 V183A probably benign Het
Shprh T C 10: 11,186,911 probably null Het
Slc39a10 T C 1: 46,836,070 H24R probably damaging Het
Slc7a13 A T 4: 19,819,046 H82L probably benign Het
Sptbn2 A G 19: 4,732,541 I502V probably benign Het
Syne2 C T 12: 76,109,862 R6811C probably damaging Het
Syt12 A G 19: 4,456,883 V78A probably benign Het
Tbck T A 3: 132,838,011 D874E probably benign Het
Tesc A T 5: 118,046,329 I25L probably damaging Het
Thoc5 T G 11: 4,914,608 D351E probably benign Het
Tor1aip1 A T 1: 156,007,562 M180K probably damaging Het
Trps1 T C 15: 50,661,136 S842G probably damaging Het
Unc79 A T 12: 103,134,478 T1858S probably damaging Het
Vmn1r193 T C 13: 22,219,391 T144A probably benign Het
Vwa8 T C 14: 79,081,136 F1046S probably benign Het
Wdr26 A T 1: 181,191,775 W346R probably damaging Het
Zfp740 T A 15: 102,207,901 V22E probably damaging Het
Zw10 C A 9: 49,069,741 S480R probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGTAAATCCAAGCAAGTG -3'
(R):5'- AACACCATATTTTCAGCATCTTATCA -3'

Sequencing Primer
(F):5'- TCCAAGCAAGTGTGAAATAAACTC -3'
(R):5'- GCACAATGGCGTAGTTAC -3'
Posted On2014-06-23