Incidental Mutation 'R1831:Ovgp1'
ID207304
Institutional Source Beutler Lab
Gene Symbol Ovgp1
Ensembl Gene ENSMUSG00000074340
Gene Nameoviductal glycoprotein 1
SynonymsChit5, MOGP, muc9, mucin 9, OGP, oviductin
MMRRC Submission 039858-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1831 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location105973711-105987423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105985068 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 346 (R346G)
Ref Sequence ENSEMBL: ENSMUSP00000000573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000573] [ENSMUST00000163626]
Predicted Effect probably benign
Transcript: ENSMUST00000000573
AA Change: R346G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000000573
Gene: ENSMUSG00000074340
AA Change: R346G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Glyco_18 22 360 1.38e-134 SMART
low complexity region 486 515 N/A INTRINSIC
low complexity region 533 626 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092878
Predicted Effect probably benign
Transcript: ENSMUST00000163626
SMART Domains Protein: ENSMUSP00000132424
Gene: ENSMUSG00000074340

DomainStartEndE-ValueType
Glyco_18 9 226 8.52e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167642
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show no phenotypic abnormalities. Female reproduction is essentially normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,577,255 D77G probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Capn8 G A 1: 182,611,101 probably null Het
Carmil1 A T 13: 24,164,879 V15E probably benign Het
Ccdc42 T A 11: 68,590,979 M133K probably benign Het
Cd5 T C 19: 10,719,569 D485G probably damaging Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Cep162 T A 9: 87,206,932 I966L probably damaging Het
Cklf T C 8: 104,251,055 F13S probably damaging Het
Csf2rb C T 15: 78,348,253 P587S probably benign Het
Cyp21a1 A T 17: 34,804,035 probably benign Het
Cyp26a1 A T 19: 37,700,623 L335F probably damaging Het
Dcst1 A G 3: 89,352,750 F596L probably damaging Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dnah6 G A 6: 73,181,797 R608C possibly damaging Het
Dnajb5 A T 4: 42,957,333 T311S probably benign Het
Dthd1 A G 5: 62,827,229 T426A probably benign Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Efemp1 A T 11: 28,921,442 D347V possibly damaging Het
Ephb4 T A 5: 137,354,415 Y87N probably damaging Het
Ern1 A T 11: 106,399,842 probably null Het
Fam184a A T 10: 53,647,084 D164E probably damaging Het
Fkbp10 A G 11: 100,423,219 E351G probably damaging Het
Fmn2 A G 1: 174,609,945 S1161G probably benign Het
Frem1 A G 4: 83,020,837 S3P possibly damaging Het
Gm10260 A G 13: 97,760,545 V15A probably benign Het
Gm281 A G 14: 13,899,619 I101T probably damaging Het
Gpr3 C T 4: 133,211,143 A73T possibly damaging Het
Gprc6a T C 10: 51,615,806 T616A probably benign Het
Gtf3c2 G T 5: 31,168,369 Q452K probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hacd2 T C 16: 35,102,064 Y208H probably damaging Het
Hid1 C T 11: 115,348,903 G734R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Itga11 T A 9: 62,782,018 L1155Q probably damaging Het
Kmt2d A G 15: 98,855,343 S157P probably damaging Het
Lamb3 A G 1: 193,334,879 T793A probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ltn1 C T 16: 87,400,146 S1213N possibly damaging Het
Med1 T C 11: 98,156,611 probably benign Het
Megf6 C T 4: 154,270,677 T1483M probably benign Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Ndst3 T A 3: 123,601,478 H501L probably benign Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nmbr C A 10: 14,766,865 T56K probably benign Het
Nxpe2 T A 9: 48,326,152 M268L probably benign Het
Oasl2 A G 5: 114,901,306 Y185C probably benign Het
Ogdhl T A 14: 32,337,527 V377E probably damaging Het
Olfr115 G A 17: 37,609,839 S304L possibly damaging Het
Olfr738 T A 14: 50,414,201 probably null Het
Parp14 T A 16: 35,858,588 N337Y possibly damaging Het
Pask A C 1: 93,320,769 probably null Het
Pax3 G T 1: 78,132,340 T227K probably damaging Het
Pik3r6 T A 11: 68,544,034 M594K probably benign Het
Pms1 A G 1: 53,207,211 F390L probably benign Het
Polg G A 7: 79,459,770 T433I probably benign Het
Prex1 T C 2: 166,585,101 Y898C probably damaging Het
Ranbp2 T A 10: 58,479,222 C1921* probably null Het
Rif1 T A 2: 52,078,495 L230* probably null Het
Rnf148 A G 6: 23,654,773 F75L probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sirt1 T C 10: 63,320,646 D735G probably benign Het
Spag5 T A 11: 78,314,256 N622K probably benign Het
Sspo T G 6: 48,489,786 C3935W probably damaging Het
Strbp A G 2: 37,625,265 S250P possibly damaging Het
Tgfbr2 T C 9: 116,090,536 T541A possibly damaging Het
Thada A C 17: 84,231,114 S1489A probably damaging Het
Tiam1 A T 16: 89,860,294 S685T probably benign Het
Tldc1 T C 8: 119,771,253 M171V probably null Het
Tpsb2 T A 17: 25,366,520 probably null Het
Trip4 C A 9: 65,858,340 G359V probably damaging Het
Tsr1 T C 11: 74,900,356 F254L probably benign Het
Vmn1r120 T C 7: 21,053,631 K52E probably benign Het
Vmn1r29 C A 6: 58,307,707 Y137* probably null Het
Vmn2r52 T C 7: 10,159,488 K575E probably damaging Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Other mutations in Ovgp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ovgp1 APN 3 105981277 nonsense probably null
IGL01152:Ovgp1 APN 3 105986172 missense possibly damaging 0.94
IGL01458:Ovgp1 APN 3 105974991 missense probably benign 0.01
IGL01646:Ovgp1 APN 3 105978349 missense probably damaging 1.00
IGL01768:Ovgp1 APN 3 105981351 critical splice donor site probably null
IGL02712:Ovgp1 APN 3 105986513 unclassified probably benign
IGL03065:Ovgp1 APN 3 105986366 missense probably benign 0.01
IGL03140:Ovgp1 APN 3 105979906 missense probably damaging 1.00
IGL03272:Ovgp1 APN 3 105981325 missense probably damaging 0.99
PIT4472001:Ovgp1 UTSW 3 105986990 missense unknown
R0277:Ovgp1 UTSW 3 105979892 intron probably benign
R0560:Ovgp1 UTSW 3 105986410 unclassified probably benign
R0718:Ovgp1 UTSW 3 105974830 splice site probably benign
R0743:Ovgp1 UTSW 3 105974932 missense probably damaging 1.00
R1362:Ovgp1 UTSW 3 105986575 unclassified probably benign
R1556:Ovgp1 UTSW 3 105986752 unclassified probably benign
R1776:Ovgp1 UTSW 3 105977798 missense possibly damaging 0.52
R1986:Ovgp1 UTSW 3 105974935 missense probably damaging 1.00
R2004:Ovgp1 UTSW 3 105986993 unclassified probably benign
R2156:Ovgp1 UTSW 3 105977717 missense possibly damaging 0.49
R2254:Ovgp1 UTSW 3 105986912 unclassified probably benign
R2860:Ovgp1 UTSW 3 105986567 unclassified probably benign
R2861:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3117:Ovgp1 UTSW 3 105986452 unclassified probably benign
R3793:Ovgp1 UTSW 3 105980171 missense probably benign 0.03
R3835:Ovgp1 UTSW 3 105986315 missense probably benign 0.00
R3894:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3894:Ovgp1 UTSW 3 105986596 unclassified probably benign
R3895:Ovgp1 UTSW 3 105986596 unclassified probably benign
R4050:Ovgp1 UTSW 3 105986596 unclassified probably benign
R4050:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4467:Ovgp1 UTSW 3 105977711 missense probably benign 0.04
R4611:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4628:Ovgp1 UTSW 3 105980323 intron probably null
R4738:Ovgp1 UTSW 3 105979918 missense probably damaging 1.00
R4944:Ovgp1 UTSW 3 105979953 missense possibly damaging 0.66
R5110:Ovgp1 UTSW 3 105977783 missense probably damaging 1.00
R6531:Ovgp1 UTSW 3 105987071 unclassified probably benign
R6540:Ovgp1 UTSW 3 105986581 nonsense probably null
R6562:Ovgp1 UTSW 3 105980273 missense probably damaging 1.00
R6601:Ovgp1 UTSW 3 105986431 unclassified probably benign
R6906:Ovgp1 UTSW 3 105986873 unclassified probably benign
R7313:Ovgp1 UTSW 3 105987071 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGCCCTCAAAGTGTTGAAAATAC -3'
(R):5'- ACCTGTCAGATTGGACCCAC -3'

Sequencing Primer
(F):5'- TTCTTGAATGAGGTAACCAAGAAAG -3'
(R):5'- TGGACCCACCAGTGTCTG -3'
Posted On2014-06-23