Incidental Mutation 'R1843:Invs'
ID207402
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Nameinversin
Synonyms
MMRRC Submission 039868-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R1843 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location48279760-48431954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48422035 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 889 (I889N)
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
Predicted Effect probably damaging
Transcript: ENSMUST00000030029
AA Change: I889N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: I889N

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143433
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 105,708,974 T88M probably damaging Het
9130011E15Rik A C 19: 45,975,252 S42R probably benign Het
9430038I01Rik A G 7: 137,377,066 probably benign Het
Adgra3 A C 5: 49,961,492 S905A probably damaging Het
Adgrv1 A G 13: 81,544,533 Y1618H probably damaging Het
Anapc15-ps T C 10: 95,673,314 T26A probably benign Het
Ankrd13d T C 19: 4,271,595 K360E probably damaging Het
Anks1b T A 10: 90,512,889 probably null Het
Apob T C 12: 8,007,602 F2028S possibly damaging Het
Arap3 G A 18: 37,975,583 R1265W probably damaging Het
Arhgef37 A G 18: 61,518,050 Y135H probably damaging Het
Atp1a1 T C 3: 101,582,017 T760A probably benign Het
Cdc42bpb T A 12: 111,322,821 M497L probably benign Het
Ces5a C T 8: 93,514,231 V413M probably damaging Het
Chd5 A T 4: 152,385,806 Y1903F probably damaging Het
Chd9 T A 8: 91,010,794 N1500K probably benign Het
Chmp7 G T 14: 69,719,799 D303E probably benign Het
Chrnb4 A T 9: 55,034,818 Y391N possibly damaging Het
Crtc1 T C 8: 70,388,152 T475A probably benign Het
Cyp2c69 A G 19: 39,877,528 I207T probably benign Het
Dcp1a A G 14: 30,518,983 E250G probably damaging Het
Ddx20 T C 3: 105,679,082 Q649R probably benign Het
Defb12 T A 8: 19,112,738 K59N probably damaging Het
Dpy19l3 A T 7: 35,729,760 I85N probably damaging Het
Duox2 C T 2: 122,292,258 probably null Het
E430018J23Rik A C 7: 127,391,488 D442E probably benign Het
Ebi3 T A 17: 55,956,679 Y197N probably damaging Het
Emc1 G A 4: 139,375,512 R994Q probably benign Het
Ercc6 G T 14: 32,546,820 M530I probably damaging Het
Evl T A 12: 108,652,996 D70E probably damaging Het
Fam35a A G 14: 34,267,803 I382T probably benign Het
Fbln2 A G 6: 91,265,775 N819S probably damaging Het
Foxk2 A G 11: 121,285,537 I170V probably benign Het
Gfm1 T C 3: 67,435,610 V159A probably damaging Het
Gm10837 A G 14: 122,490,765 T18A unknown Het
Gm12887 A T 4: 121,622,030 V25E probably damaging Het
Hectd4 A G 5: 121,297,180 H985R possibly damaging Het
Hsfy2 A G 1: 56,636,632 Y249H possibly damaging Het
Hspg2 T C 4: 137,545,567 V2639A probably damaging Het
Igf2r A G 17: 12,704,270 probably null Het
Kcnq1 A T 7: 143,183,120 M209L probably benign Het
Klra7 A G 6: 130,229,994 I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrif1 T A 3: 106,732,811 V404D probably damaging Het
Lrriq1 T A 10: 103,227,173 probably null Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Mbp A G 18: 82,584,122 D174G probably damaging Het
Megf9 G T 4: 70,534,785 P13Q probably damaging Het
Myo15b A T 11: 115,869,586 T1155S probably benign Het
Nlrp6 T A 7: 140,923,093 C371S probably damaging Het
Nosip T A 7: 45,077,309 probably null Het
Nox3 G T 17: 3,669,878 P344H probably damaging Het
Nup210l T C 3: 90,172,086 V959A probably damaging Het
Olfr1360 C A 13: 21,674,672 V91L probably benign Het
Olfr1475 A G 19: 13,479,931 I89T probably benign Het
Olfr175-ps1 T A 16: 58,824,077 I211F probably damaging Het
Olfr267 T C 4: 58,785,384 I113V probably benign Het
Olfr959 A G 9: 39,572,735 Y175H possibly damaging Het
Osbpl3 A C 6: 50,370,143 S25A probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pax7 G A 4: 139,784,491 R260C probably damaging Het
Pbrm1 A T 14: 31,038,957 I224F probably damaging Het
Pcdh1 T A 18: 38,192,225 probably null Het
Pcnx T C 12: 81,980,935 L1585P probably damaging Het
Pde4c C T 8: 70,747,950 H362Y probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pgm2 A T 4: 99,961,478 Q90L probably damaging Het
Phlpp1 A G 1: 106,343,505 H814R probably benign Het
Pknox2 A T 9: 36,954,831 M5K possibly damaging Het
Pole G A 5: 110,330,835 probably null Het
Polr1b A G 2: 129,102,966 I61V probably benign Het
Prelp T C 1: 133,914,757 K217E probably damaging Het
Prkce C T 17: 86,475,546 Q202* probably null Het
Psmd2 T G 16: 20,656,582 M370R probably benign Het
Rimklb A T 6: 122,464,009 H68Q probably damaging Het
Rnasel A G 1: 153,754,674 D312G possibly damaging Het
Rxrg A T 1: 167,598,752 M1L probably benign Het
Scrn1 A G 6: 54,522,841 F220L possibly damaging Het
Scyl3 A G 1: 163,950,675 S461G probably benign Het
Serpina1c T A 12: 103,895,023 T411S probably benign Het
Serpinb6d C T 13: 33,671,381 P346L probably benign Het
Slc9a3r2 C T 17: 24,641,719 S150N possibly damaging Het
Spg21 G T 9: 65,465,336 V17F probably damaging Het
Spink5 A T 18: 43,999,891 M525L probably benign Het
Sun2 T C 15: 79,737,563 T155A probably benign Het
Tchh T A 3: 93,446,780 F1176I unknown Het
Tex15 T A 8: 33,576,654 D2037E probably benign Het
Tfdp2 T C 9: 96,317,804 C392R possibly damaging Het
Tmem30c T C 16: 57,276,780 N139S probably benign Het
Tns2 C T 15: 102,113,133 probably null Het
Trim66 T C 7: 109,475,839 E405G probably damaging Het
Trpc4 T A 3: 54,279,994 F456I probably benign Het
Tspo2 T C 17: 48,448,790 D108G possibly damaging Het
Tyk2 A T 9: 21,121,554 C304* probably null Het
Vgll4 A T 6: 114,862,795 S185T probably benign Het
Vmn2r94 A C 17: 18,244,470 S519R probably benign Het
Vmn2r96 T G 17: 18,597,921 S587A probably benign Het
Vps4b C A 1: 106,778,982 A287S possibly damaging Het
Yeats2 C T 16: 20,229,564 P1332S probably benign Het
Zfp462 T G 4: 55,010,010 S659A possibly damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zswim5 G T 4: 116,877,699 E80D unknown Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48402909 missense probably damaging 0.98
IGL00487:Invs APN 4 48407689 nonsense probably null
IGL01487:Invs APN 4 48398136 missense probably benign 0.26
IGL01696:Invs APN 4 48425997 missense probably damaging 1.00
IGL02238:Invs APN 4 48390029 missense probably damaging 1.00
IGL03286:Invs APN 4 48382261 missense probably benign 0.26
R0645:Invs UTSW 4 48407653 missense probably benign 0.00
R0661:Invs UTSW 4 48421861 missense probably benign
R0698:Invs UTSW 4 48396364 missense probably benign 0.04
R0763:Invs UTSW 4 48392628 missense possibly damaging 0.82
R1183:Invs UTSW 4 48421725 missense possibly damaging 0.68
R1381:Invs UTSW 4 48421942 nonsense probably null
R1511:Invs UTSW 4 48382148 missense possibly damaging 0.82
R1903:Invs UTSW 4 48402824 splice site probably null
R1928:Invs UTSW 4 48390095 missense probably damaging 1.00
R1990:Invs UTSW 4 48392599 missense possibly damaging 0.88
R2063:Invs UTSW 4 48396287 missense probably damaging 1.00
R2064:Invs UTSW 4 48396287 missense probably damaging 1.00
R2065:Invs UTSW 4 48396287 missense probably damaging 1.00
R2066:Invs UTSW 4 48396287 missense probably damaging 1.00
R4744:Invs UTSW 4 48397609 missense probably damaging 1.00
R4997:Invs UTSW 4 48396332 missense probably damaging 0.98
R5011:Invs UTSW 4 48421807 missense probably damaging 1.00
R5013:Invs UTSW 4 48421807 missense probably damaging 1.00
R5083:Invs UTSW 4 48396307 missense possibly damaging 0.90
R5184:Invs UTSW 4 48283242 utr 5 prime probably benign
R5258:Invs UTSW 4 48396374 missense possibly damaging 0.82
R5375:Invs UTSW 4 48385262 missense probably benign 0.12
R5509:Invs UTSW 4 48396337 missense probably damaging 1.00
R5560:Invs UTSW 4 48416084 missense probably benign 0.00
R5748:Invs UTSW 4 48307823 missense probably damaging 0.98
R5813:Invs UTSW 4 48398146 missense probably damaging 0.98
R5840:Invs UTSW 4 48396284 missense probably damaging 1.00
R5984:Invs UTSW 4 48421674 missense probably benign 0.00
R6513:Invs UTSW 4 48397534 missense possibly damaging 0.46
R6637:Invs UTSW 4 48416203 splice site probably null
R6667:Invs UTSW 4 48402870 missense possibly damaging 0.66
R6838:Invs UTSW 4 48283278 missense possibly damaging 0.95
R6921:Invs UTSW 4 48396260 missense possibly damaging 0.46
R6945:Invs UTSW 4 48421785 missense probably benign 0.00
R7102:Invs UTSW 4 48407674 missense not run
R7142:Invs UTSW 4 48407696 missense not run
X0026:Invs UTSW 4 48398221 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGCTGATCAGAGTTCTCTCC -3'
(R):5'- CCACTGTCCTAAGCTCACTG -3'

Sequencing Primer
(F):5'- GATCAGAGTTCTCTCCACCGTCAC -3'
(R):5'- TGTCCTAAGCTCACTGGGACAC -3'
Posted On2014-06-23