Incidental Mutation 'R1843:Nox3'
ID207482
Institutional Source Beutler Lab
Gene Symbol Nox3
Ensembl Gene ENSMUSG00000023802
Gene NameNADPH oxidase 3
Synonymsnmf250, het
MMRRC Submission 039868-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R1843 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location3635240-3696261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3669878 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 344 (P344H)
Ref Sequence ENSEMBL: ENSMUSP00000111466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115800]
Predicted Effect probably damaging
Transcript: ENSMUST00000024565
AA Change: P364H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024565
Gene: ENSMUSG00000023802
AA Change: P364H

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Ferric_reduct 75 238 8.6e-28 PFAM
Pfam:FAD_binding_8 311 413 4.1e-26 PFAM
Pfam:NAD_binding_6 419 569 1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115800
AA Change: P344H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111466
Gene: ENSMUSG00000023802
AA Change: P344H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 55 218 5.4e-23 PFAM
Pfam:FAD_binding_6 290 379 1.8e-8 PFAM
Pfam:FAD_binding_8 291 393 1.5e-27 PFAM
Pfam:NAD_binding_6 399 549 1e-34 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NOX family of NADPH oxidases. These enzymes catalyze the transfer of electrons from NADPH to molecular oxygen to produce superoxide and other reactive oxygen species (ROS). The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia, which are crystalline structures of the inner ear involved in the perception of gravity and linear acceleration. In mouse mutations of this gene lead to the absence of otoconia and vestibular dysfunction. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous mutants bilaterally lack otoliths in otherwise normal ears and display impaired swimming ability, motor capabilities, and vestibular responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 105,708,974 T88M probably damaging Het
9130011E15Rik A C 19: 45,975,252 S42R probably benign Het
9430038I01Rik A G 7: 137,377,066 probably benign Het
Adgra3 A C 5: 49,961,492 S905A probably damaging Het
Adgrv1 A G 13: 81,544,533 Y1618H probably damaging Het
Anapc15-ps T C 10: 95,673,314 T26A probably benign Het
Ankrd13d T C 19: 4,271,595 K360E probably damaging Het
Anks1b T A 10: 90,512,889 probably null Het
Apob T C 12: 8,007,602 F2028S possibly damaging Het
Arap3 G A 18: 37,975,583 R1265W probably damaging Het
Arhgef37 A G 18: 61,518,050 Y135H probably damaging Het
Atp1a1 T C 3: 101,582,017 T760A probably benign Het
Cdc42bpb T A 12: 111,322,821 M497L probably benign Het
Ces5a C T 8: 93,514,231 V413M probably damaging Het
Chd5 A T 4: 152,385,806 Y1903F probably damaging Het
Chd9 T A 8: 91,010,794 N1500K probably benign Het
Chmp7 G T 14: 69,719,799 D303E probably benign Het
Chrnb4 A T 9: 55,034,818 Y391N possibly damaging Het
Crtc1 T C 8: 70,388,152 T475A probably benign Het
Cyp2c69 A G 19: 39,877,528 I207T probably benign Het
Dcp1a A G 14: 30,518,983 E250G probably damaging Het
Ddx20 T C 3: 105,679,082 Q649R probably benign Het
Defb12 T A 8: 19,112,738 K59N probably damaging Het
Dpy19l3 A T 7: 35,729,760 I85N probably damaging Het
Duox2 C T 2: 122,292,258 probably null Het
E430018J23Rik A C 7: 127,391,488 D442E probably benign Het
Ebi3 T A 17: 55,956,679 Y197N probably damaging Het
Emc1 G A 4: 139,375,512 R994Q probably benign Het
Ercc6 G T 14: 32,546,820 M530I probably damaging Het
Evl T A 12: 108,652,996 D70E probably damaging Het
Fam35a A G 14: 34,267,803 I382T probably benign Het
Fbln2 A G 6: 91,265,775 N819S probably damaging Het
Foxk2 A G 11: 121,285,537 I170V probably benign Het
Gfm1 T C 3: 67,435,610 V159A probably damaging Het
Gm10837 A G 14: 122,490,765 T18A unknown Het
Gm12887 A T 4: 121,622,030 V25E probably damaging Het
Hectd4 A G 5: 121,297,180 H985R possibly damaging Het
Hsfy2 A G 1: 56,636,632 Y249H possibly damaging Het
Hspg2 T C 4: 137,545,567 V2639A probably damaging Het
Igf2r A G 17: 12,704,270 probably null Het
Invs T A 4: 48,422,035 I889N probably damaging Het
Kcnq1 A T 7: 143,183,120 M209L probably benign Het
Klra7 A G 6: 130,229,994 I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrif1 T A 3: 106,732,811 V404D probably damaging Het
Lrriq1 T A 10: 103,227,173 probably null Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Mbp A G 18: 82,584,122 D174G probably damaging Het
Megf9 G T 4: 70,534,785 P13Q probably damaging Het
Myo15b A T 11: 115,869,586 T1155S probably benign Het
Nlrp6 T A 7: 140,923,093 C371S probably damaging Het
Nosip T A 7: 45,077,309 probably null Het
Nup210l T C 3: 90,172,086 V959A probably damaging Het
Olfr1360 C A 13: 21,674,672 V91L probably benign Het
Olfr1475 A G 19: 13,479,931 I89T probably benign Het
Olfr175-ps1 T A 16: 58,824,077 I211F probably damaging Het
Olfr267 T C 4: 58,785,384 I113V probably benign Het
Olfr959 A G 9: 39,572,735 Y175H possibly damaging Het
Osbpl3 A C 6: 50,370,143 S25A probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pax7 G A 4: 139,784,491 R260C probably damaging Het
Pbrm1 A T 14: 31,038,957 I224F probably damaging Het
Pcdh1 T A 18: 38,192,225 probably null Het
Pcnx T C 12: 81,980,935 L1585P probably damaging Het
Pde4c C T 8: 70,747,950 H362Y probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pgm2 A T 4: 99,961,478 Q90L probably damaging Het
Phlpp1 A G 1: 106,343,505 H814R probably benign Het
Pknox2 A T 9: 36,954,831 M5K possibly damaging Het
Pole G A 5: 110,330,835 probably null Het
Polr1b A G 2: 129,102,966 I61V probably benign Het
Prelp T C 1: 133,914,757 K217E probably damaging Het
Prkce C T 17: 86,475,546 Q202* probably null Het
Psmd2 T G 16: 20,656,582 M370R probably benign Het
Rimklb A T 6: 122,464,009 H68Q probably damaging Het
Rnasel A G 1: 153,754,674 D312G possibly damaging Het
Rxrg A T 1: 167,598,752 M1L probably benign Het
Scrn1 A G 6: 54,522,841 F220L possibly damaging Het
Scyl3 A G 1: 163,950,675 S461G probably benign Het
Serpina1c T A 12: 103,895,023 T411S probably benign Het
Serpinb6d C T 13: 33,671,381 P346L probably benign Het
Slc9a3r2 C T 17: 24,641,719 S150N possibly damaging Het
Spg21 G T 9: 65,465,336 V17F probably damaging Het
Spink5 A T 18: 43,999,891 M525L probably benign Het
Sun2 T C 15: 79,737,563 T155A probably benign Het
Tchh T A 3: 93,446,780 F1176I unknown Het
Tex15 T A 8: 33,576,654 D2037E probably benign Het
Tfdp2 T C 9: 96,317,804 C392R possibly damaging Het
Tmem30c T C 16: 57,276,780 N139S probably benign Het
Tns2 C T 15: 102,113,133 probably null Het
Trim66 T C 7: 109,475,839 E405G probably damaging Het
Trpc4 T A 3: 54,279,994 F456I probably benign Het
Tspo2 T C 17: 48,448,790 D108G possibly damaging Het
Tyk2 A T 9: 21,121,554 C304* probably null Het
Vgll4 A T 6: 114,862,795 S185T probably benign Het
Vmn2r94 A C 17: 18,244,470 S519R probably benign Het
Vmn2r96 T G 17: 18,597,921 S587A probably benign Het
Vps4b C A 1: 106,778,982 A287S possibly damaging Het
Yeats2 C T 16: 20,229,564 P1332S probably benign Het
Zfp462 T G 4: 55,010,010 S659A possibly damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zswim5 G T 4: 116,877,699 E80D unknown Het
Other mutations in Nox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Nox3 APN 17 3683015 missense probably damaging 0.99
IGL01135:Nox3 APN 17 3696252 utr 5 prime probably benign
IGL01791:Nox3 APN 17 3682943 missense possibly damaging 0.68
IGL02423:Nox3 APN 17 3682916 missense probably damaging 1.00
IGL03091:Nox3 APN 17 3665844 missense probably benign 0.42
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0085:Nox3 UTSW 17 3635281 missense probably benign 0.14
R0426:Nox3 UTSW 17 3695563 missense probably damaging 1.00
R0690:Nox3 UTSW 17 3695564 missense probably damaging 1.00
R1281:Nox3 UTSW 17 3696185 missense probably damaging 1.00
R1350:Nox3 UTSW 17 3650121 missense probably damaging 1.00
R1902:Nox3 UTSW 17 3670017 missense probably damaging 1.00
R2023:Nox3 UTSW 17 3694021 splice site probably benign
R2762:Nox3 UTSW 17 3696158 missense probably benign 0.35
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R4429:Nox3 UTSW 17 3682958 missense probably benign 0.05
R4630:Nox3 UTSW 17 3693982 missense possibly damaging 0.53
R4926:Nox3 UTSW 17 3669894 missense probably damaging 1.00
R4928:Nox3 UTSW 17 3635275 missense probably null 1.00
R5181:Nox3 UTSW 17 3635286 nonsense probably null
R6911:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R6912:Nox3 UTSW 17 3685923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTGAAGTAGCACAGCTTG -3'
(R):5'- TATGGACAGAAGAATGTGCTCTTG -3'

Sequencing Primer
(F):5'- CAGCTTGTATATAACAGTGACCTGGG -3'
(R):5'- TACCTGAGTGAGAATCCCCTTGG -3'
Posted On2014-06-23