Incidental Mutation 'R1843:Spink5'
ID207492
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
MMRRC Submission 039868-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1843 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43999891 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 525 (M525L)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect probably benign
Transcript: ENSMUST00000069245
AA Change: M525L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: M525L

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 105,708,974 T88M probably damaging Het
9130011E15Rik A C 19: 45,975,252 S42R probably benign Het
9430038I01Rik A G 7: 137,377,066 probably benign Het
Adgra3 A C 5: 49,961,492 S905A probably damaging Het
Adgrv1 A G 13: 81,544,533 Y1618H probably damaging Het
Anapc15-ps T C 10: 95,673,314 T26A probably benign Het
Ankrd13d T C 19: 4,271,595 K360E probably damaging Het
Anks1b T A 10: 90,512,889 probably null Het
Apob T C 12: 8,007,602 F2028S possibly damaging Het
Arap3 G A 18: 37,975,583 R1265W probably damaging Het
Arhgef37 A G 18: 61,518,050 Y135H probably damaging Het
Atp1a1 T C 3: 101,582,017 T760A probably benign Het
Cdc42bpb T A 12: 111,322,821 M497L probably benign Het
Ces5a C T 8: 93,514,231 V413M probably damaging Het
Chd5 A T 4: 152,385,806 Y1903F probably damaging Het
Chd9 T A 8: 91,010,794 N1500K probably benign Het
Chmp7 G T 14: 69,719,799 D303E probably benign Het
Chrnb4 A T 9: 55,034,818 Y391N possibly damaging Het
Crtc1 T C 8: 70,388,152 T475A probably benign Het
Cyp2c69 A G 19: 39,877,528 I207T probably benign Het
Dcp1a A G 14: 30,518,983 E250G probably damaging Het
Ddx20 T C 3: 105,679,082 Q649R probably benign Het
Defb12 T A 8: 19,112,738 K59N probably damaging Het
Dpy19l3 A T 7: 35,729,760 I85N probably damaging Het
Duox2 C T 2: 122,292,258 probably null Het
E430018J23Rik A C 7: 127,391,488 D442E probably benign Het
Ebi3 T A 17: 55,956,679 Y197N probably damaging Het
Emc1 G A 4: 139,375,512 R994Q probably benign Het
Ercc6 G T 14: 32,546,820 M530I probably damaging Het
Evl T A 12: 108,652,996 D70E probably damaging Het
Fam35a A G 14: 34,267,803 I382T probably benign Het
Fbln2 A G 6: 91,265,775 N819S probably damaging Het
Foxk2 A G 11: 121,285,537 I170V probably benign Het
Gfm1 T C 3: 67,435,610 V159A probably damaging Het
Gm10837 A G 14: 122,490,765 T18A unknown Het
Gm12887 A T 4: 121,622,030 V25E probably damaging Het
Hectd4 A G 5: 121,297,180 H985R possibly damaging Het
Hsfy2 A G 1: 56,636,632 Y249H possibly damaging Het
Hspg2 T C 4: 137,545,567 V2639A probably damaging Het
Igf2r A G 17: 12,704,270 probably null Het
Invs T A 4: 48,422,035 I889N probably damaging Het
Kcnq1 A T 7: 143,183,120 M209L probably benign Het
Klra7 A G 6: 130,229,994 I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrif1 T A 3: 106,732,811 V404D probably damaging Het
Lrriq1 T A 10: 103,227,173 probably null Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Mbp A G 18: 82,584,122 D174G probably damaging Het
Megf9 G T 4: 70,534,785 P13Q probably damaging Het
Myo15b A T 11: 115,869,586 T1155S probably benign Het
Nlrp6 T A 7: 140,923,093 C371S probably damaging Het
Nosip T A 7: 45,077,309 probably null Het
Nox3 G T 17: 3,669,878 P344H probably damaging Het
Nup210l T C 3: 90,172,086 V959A probably damaging Het
Olfr1360 C A 13: 21,674,672 V91L probably benign Het
Olfr1475 A G 19: 13,479,931 I89T probably benign Het
Olfr175-ps1 T A 16: 58,824,077 I211F probably damaging Het
Olfr267 T C 4: 58,785,384 I113V probably benign Het
Olfr959 A G 9: 39,572,735 Y175H possibly damaging Het
Osbpl3 A C 6: 50,370,143 S25A probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pax7 G A 4: 139,784,491 R260C probably damaging Het
Pbrm1 A T 14: 31,038,957 I224F probably damaging Het
Pcdh1 T A 18: 38,192,225 probably null Het
Pcnx T C 12: 81,980,935 L1585P probably damaging Het
Pde4c C T 8: 70,747,950 H362Y probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pgm2 A T 4: 99,961,478 Q90L probably damaging Het
Phlpp1 A G 1: 106,343,505 H814R probably benign Het
Pknox2 A T 9: 36,954,831 M5K possibly damaging Het
Pole G A 5: 110,330,835 probably null Het
Polr1b A G 2: 129,102,966 I61V probably benign Het
Prelp T C 1: 133,914,757 K217E probably damaging Het
Prkce C T 17: 86,475,546 Q202* probably null Het
Psmd2 T G 16: 20,656,582 M370R probably benign Het
Rimklb A T 6: 122,464,009 H68Q probably damaging Het
Rnasel A G 1: 153,754,674 D312G possibly damaging Het
Rxrg A T 1: 167,598,752 M1L probably benign Het
Scrn1 A G 6: 54,522,841 F220L possibly damaging Het
Scyl3 A G 1: 163,950,675 S461G probably benign Het
Serpina1c T A 12: 103,895,023 T411S probably benign Het
Serpinb6d C T 13: 33,671,381 P346L probably benign Het
Slc9a3r2 C T 17: 24,641,719 S150N possibly damaging Het
Spg21 G T 9: 65,465,336 V17F probably damaging Het
Sun2 T C 15: 79,737,563 T155A probably benign Het
Tchh T A 3: 93,446,780 F1176I unknown Het
Tex15 T A 8: 33,576,654 D2037E probably benign Het
Tfdp2 T C 9: 96,317,804 C392R possibly damaging Het
Tmem30c T C 16: 57,276,780 N139S probably benign Het
Tns2 C T 15: 102,113,133 probably null Het
Trim66 T C 7: 109,475,839 E405G probably damaging Het
Trpc4 T A 3: 54,279,994 F456I probably benign Het
Tspo2 T C 17: 48,448,790 D108G possibly damaging Het
Tyk2 A T 9: 21,121,554 C304* probably null Het
Vgll4 A T 6: 114,862,795 S185T probably benign Het
Vmn2r94 A C 17: 18,244,470 S519R probably benign Het
Vmn2r96 T G 17: 18,597,921 S587A probably benign Het
Vps4b C A 1: 106,778,982 A287S possibly damaging Het
Yeats2 C T 16: 20,229,564 P1332S probably benign Het
Zfp462 T G 4: 55,010,010 S659A possibly damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zswim5 G T 4: 116,877,699 E80D unknown Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGGCTAAAGCTGATATCTGAC -3'
(R):5'- AAGTACTGTCAGTGTGTGGC -3'

Sequencing Primer
(F):5'- GCACATCACAGTTTTCAAAGGG -3'
(R):5'- GTGGCTTGATGATAATATACCCTGCC -3'
Posted On2014-06-23