Incidental Mutation 'R0115:Taf11'
ID20753
Institutional Source Beutler Lab
Gene Symbol Taf11
Ensembl Gene ENSMUSG00000024218
Gene NameTATA-box binding protein associated factor 11
Synonyms28kDa, 1110038O14Rik, TAF2I, PRO214, TAFII28
MMRRC Submission 038401-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0115 (G1)
Quality Score183
Status Validated (trace)
Chromosome17
Chromosomal Location27901122-27909242 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27907661 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 4 (L4P)
Ref Sequence ENSEMBL: ENSMUSP00000110498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025057] [ENSMUST00000025058] [ENSMUST00000088027] [ENSMUST00000114842] [ENSMUST00000114848]
Predicted Effect probably benign
Transcript: ENSMUST00000025057
AA Change: L4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025057
Gene: ENSMUSG00000024218
AA Change: L4P

DomainStartEndE-ValueType
low complexity region 45 60 N/A INTRINSIC
low complexity region 82 105 N/A INTRINSIC
Pfam:TAFII28 106 194 1.7e-38 PFAM
Pfam:CBFD_NFYB_HMF 127 191 8.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025058
SMART Domains Protein: ENSMUSP00000025058
Gene: ENSMUSG00000024219

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
low complexity region 1126 1135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088027
SMART Domains Protein: ENSMUSP00000085344
Gene: ENSMUSG00000024219

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 144 173 1.88e-5 SMART
ANK 177 206 1.93e-2 SMART
ANK 210 239 1.64e-5 SMART
ANK 242 271 7.71e-2 SMART
low complexity region 398 418 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
SAM 688 757 3.2e-16 SMART
SAM 762 830 4.33e-13 SMART
Blast:PTB 840 898 2e-22 BLAST
PTB 932 1066 3.17e-43 SMART
low complexity region 1105 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114842
SMART Domains Protein: ENSMUSP00000110491
Gene: ENSMUSG00000024219

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114848
AA Change: L4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110498
Gene: ENSMUSG00000024218
AA Change: L4P

DomainStartEndE-ValueType
low complexity region 45 60 N/A INTRINSIC
low complexity region 82 105 N/A INTRINSIC
Pfam:TAFII28 108 193 3.1e-40 PFAM
Pfam:CBFD_NFYB_HMF 127 191 6.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155667
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a small subunit of TFIID that is present in all TFIID complexes and interacts with TBP. This subunit also interacts with another small subunit, TAF13, to form a heterodimer with a structure similar to the histone core structure. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,594,142 probably benign Het
2310007B03Rik A T 1: 93,159,725 S135R possibly damaging Het
4921528I07Rik A G 9: 114,279,384 noncoding transcript Het
Alas1 A T 9: 106,238,252 probably null Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
Arhgap20 T A 9: 51,838,972 I344N probably damaging Het
Arhgap30 A C 1: 171,407,948 E630A possibly damaging Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bysl C T 17: 47,610,942 R77Q probably benign Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccdc146 T C 5: 21,322,756 I187M possibly damaging Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Ces5a A T 8: 93,502,183 M473K probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Cyp2c50 T A 19: 40,092,393 probably benign Het
Dlg1 C A 16: 31,805,690 Y399* probably null Het
Drosha A T 15: 12,846,130 E92D probably benign Het
Fanca C T 8: 123,268,539 G1408D probably benign Het
Frem1 T A 4: 82,936,169 D1621V possibly damaging Het
Frem2 G A 3: 53,656,208 R293C probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Glipr1 A G 10: 111,993,541 I105T probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Gm281 A G 14: 13,899,571 V117A probably damaging Het
Gon4l T A 3: 88,895,682 V1200D probably damaging Het
Gpc1 G A 1: 92,857,499 D387N probably damaging Het
Gsdmc A G 15: 63,803,637 Y110H probably damaging Het
Gucy1b1 T A 3: 82,034,391 H586L probably benign Het
Gucy2e A G 11: 69,236,632 L5P unknown Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hmcn1 T A 1: 150,808,647 I391F possibly damaging Het
Hsf4 A T 8: 105,272,704 probably null Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnma1 C A 14: 23,314,175 R980L probably damaging Het
Kif1a A G 1: 93,046,778 probably benign Het
Klhdc7b A G 15: 89,388,521 H1202R probably benign Het
Lig3 A G 11: 82,793,935 D559G probably damaging Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
March6 A T 15: 31,475,812 F633I probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Megf10 G T 18: 57,259,802 V424L possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mut C T 17: 40,956,227 T564M probably damaging Het
Myh8 A G 11: 67,306,264 probably benign Het
Mypn T C 10: 63,192,380 probably benign Het
Nf1 G A 11: 79,468,876 probably null Het
Notch3 T A 17: 32,133,462 T1866S possibly damaging Het
Olfr108 C T 17: 37,445,779 A86V probably benign Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr390 A G 11: 73,787,315 I126V possibly damaging Het
Pkhd1 A T 1: 20,350,490 I2464N probably damaging Het
Pkn1 A G 8: 83,671,029 S817P probably damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Psmd1 C T 1: 86,083,271 T356I possibly damaging Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rbm42 G A 7: 30,647,775 T106I probably damaging Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rorc T C 3: 94,377,609 probably benign Het
Rpl22l1 T C 3: 28,806,536 F15L probably damaging Het
Slc6a20a C A 9: 123,678,758 A17S possibly damaging Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Sp100 A G 1: 85,650,131 probably benign Het
Ssc5d G A 7: 4,927,881 probably benign Het
Tm2d3 A G 7: 65,695,334 probably benign Het
Tmub2 T C 11: 102,288,375 probably null Het
Trim34a T A 7: 104,247,902 C58S probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r74 T C 7: 85,957,356 M261V probably benign Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Wdr95 A T 5: 149,564,390 D163V probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Ythdc2 C T 18: 44,841,423 probably benign Het
Other mutations in Taf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1627:Taf11 UTSW 17 27905279 missense probably benign 0.02
R3782:Taf11 UTSW 17 27903193 unclassified probably benign
R4126:Taf11 UTSW 17 27901772 missense possibly damaging 0.71
R5861:Taf11 UTSW 17 27901670 missense probably benign 0.00
R6789:Taf11 UTSW 17 27907518 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTGCAGACTCACAAACAGTCGTG -3'
(R):5'- TTGGGAAATCCGAGGTTAGGTCGC -3'

Sequencing Primer
(F):5'- AATTCTAGTTCCCTGGCTTTGGAAG -3'
(R):5'- TTGGCATTACATTCCCAGGAAGG -3'
Posted On2013-04-11