Incidental Mutation 'R1844:Hdac7'
ID207591
Institutional Source Beutler Lab
Gene Symbol Hdac7
Ensembl Gene ENSMUSG00000022475
Gene Namehistone deacetylase 7
SynonymsHdac7a, 5830434K02Rik
MMRRC Submission 039869-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1844 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location97792664-97844502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97807976 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 385 (Q385K)
Ref Sequence ENSEMBL: ENSMUSP00000078766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079838] [ENSMUST00000088402] [ENSMUST00000116408] [ENSMUST00000116409] [ENSMUST00000118294] [ENSMUST00000119670] [ENSMUST00000120683] [ENSMUST00000121514] [ENSMUST00000156045]
Predicted Effect probably damaging
Transcript: ENSMUST00000079838
AA Change: Q385K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078766
Gene: ENSMUSG00000022475
AA Change: Q385K

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 485 498 N/A INTRINSIC
Pfam:Hist_deacetyl 523 853 2.5e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000088402
AA Change: Q372K

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085744
Gene: ENSMUSG00000022475
AA Change: Q372K

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
Pfam:Hist_deacetyl 517 847 2.5e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116408
AA Change: Q350K

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112109
Gene: ENSMUSG00000022475
AA Change: Q350K

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 825 2.3e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116409
AA Change: Q387K

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112110
Gene: ENSMUSG00000022475
AA Change: Q387K

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Pfam:Hist_deacetyl 532 862 9.1e-83 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118294
AA Change: Q387K

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113380
Gene: ENSMUSG00000022475
AA Change: Q387K

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
Pfam:Hist_deacetyl 525 855 2.6e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119670
AA Change: Q326K

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112459
Gene: ENSMUSG00000022475
AA Change: Q326K

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 174 189 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
low complexity region 374 386 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
low complexity region 433 446 N/A INTRINSIC
Pfam:Hist_deacetyl 471 801 2.3e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120683
AA Change: Q350K

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112446
Gene: ENSMUSG00000022475
AA Change: Q350K

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 623 7.9e-9 PFAM
Pfam:Hist_deacetyl 623 777 3.5e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121514
AA Change: Q350K

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112641
Gene: ENSMUSG00000022475
AA Change: Q350K

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Pfam:Hist_deacetyl 430 760 9e-92 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000134258
AA Change: Q3K
SMART Domains Protein: ENSMUSP00000118599
Gene: ENSMUSG00000022475
AA Change: Q3K

DomainStartEndE-ValueType
low complexity region 52 64 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 111 124 N/A INTRINSIC
PDB:3ZNS|C 127 241 5e-70 PDB
SCOP:d1c3pa_ 139 219 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135651
SMART Domains Protein: ENSMUSP00000119970
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
Pfam:Hist_deacetyl 166 213 8.8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156045
AA Change: Q372K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120576
Gene: ENSMUSG00000022475
AA Change: Q372K

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
PDB:3ZNS|C 495 602 2e-60 PDB
SCOP:d1c3pa_ 507 587 6e-16 SMART
low complexity region 603 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228466
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to mouse HDAC7 gene whose protein promotes repression mediated via the transcriptional corepressor SMRT. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of this gene result in embryonic lethality by E11, due to vascular defects which are due to endothelial cell adhesion defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,976,092 I212N probably benign Het
Aco1 A G 4: 40,197,566 K857E probably benign Het
Adam20 A G 8: 40,796,043 N397D probably benign Het
Adgrf3 T G 5: 30,199,213 D347A probably damaging Het
Ang6 C T 14: 44,001,873 E133K possibly damaging Het
Arhgap23 T A 11: 97,463,408 W205R probably damaging Het
Arhgef40 C A 14: 51,997,623 R1086S probably damaging Het
Atr G T 9: 95,905,817 A1488S probably benign Het
Cabin1 A T 10: 75,743,350 probably null Het
Cdh22 A C 2: 165,143,694 F324C probably damaging Het
Cep350 T C 1: 155,848,628 I3075V probably damaging Het
Chd9 A T 8: 90,956,695 K588* probably null Het
Clns1a A T 7: 97,696,859 I44F probably damaging Het
Colgalt1 T C 8: 71,611,351 I51T possibly damaging Het
Cpt2 C T 4: 107,904,255 E217K possibly damaging Het
Ctss A G 3: 95,546,794 probably null Het
Cyp1a1 A G 9: 57,702,697 T465A probably benign Het
Dbn1 A G 13: 55,481,347 probably null Het
Dennd1b A G 1: 139,090,405 probably null Het
Dnajc1 A C 2: 18,294,027 Y49* probably null Het
Dock10 T A 1: 80,543,201 I1188L probably damaging Het
Dsg1c T G 18: 20,283,039 probably null Het
Efcab6 G A 15: 83,967,621 T352I possibly damaging Het
Eps8l3 T C 3: 107,879,586 L26P possibly damaging Het
Fbxw26 A G 9: 109,724,878 V231A probably benign Het
Fetub G A 16: 22,935,669 E209K possibly damaging Het
Galc A T 12: 98,246,297 probably null Het
Gm6871 A T 7: 41,573,468 N65K probably benign Het
Gm8857 T C 5: 10,949,027 probably benign Het
Gstp3 A G 19: 4,057,540 I208T probably benign Het
Gtpbp3 A G 8: 71,492,628 Y448C probably benign Het
Hemgn C T 4: 46,396,655 V194M possibly damaging Het
Idh2 G C 7: 80,098,877 T113R probably benign Het
Jarid2 A C 13: 44,902,743 K336T possibly damaging Het
Kcnj4 C T 15: 79,485,015 V255M probably damaging Het
Ldhb C A 6: 142,494,208 W202L probably damaging Het
Lmbrd2 T A 15: 9,177,751 Y512* probably null Het
Lrp1 A G 10: 127,595,283 probably null Het
Map3k12 G A 15: 102,503,535 P365S probably damaging Het
Map3k5 G A 10: 20,104,163 D806N probably benign Het
Matn3 A G 12: 8,967,662 E438G possibly damaging Het
Mcmbp G A 7: 128,723,974 L97F probably damaging Het
Mmp3 A T 9: 7,453,662 I428L probably benign Het
Mphosph8 T C 14: 56,697,159 V855A probably damaging Het
Mycbp2 T A 14: 103,155,714 H3027L possibly damaging Het
Nbea C T 3: 56,082,436 R333H probably damaging Het
Notch1 G T 2: 26,460,434 H2231Q probably benign Het
Npas2 A T 1: 39,325,375 H266L probably damaging Het
Oas3 A G 5: 120,759,980 S833P probably damaging Het
Olfr1141 A C 2: 87,753,990 M1R probably null Het
Olfr344 T C 2: 36,568,777 Y60H probably damaging Het
Olfr808 G A 10: 129,767,856 R120H probably benign Het
Olfr994 T C 2: 85,429,921 T303A probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pitpnm1 T C 19: 4,112,395 V1075A probably damaging Het
Pkp3 G A 7: 141,088,502 V555M probably damaging Het
Plekhm2 T C 4: 141,632,374 T381A probably benign Het
Plppr3 A G 10: 79,866,410 probably null Het
Ppp2r5e A T 12: 75,469,766 F216I possibly damaging Het
Ppp3ca T A 3: 136,921,911 V412D probably benign Het
Prss50 A G 9: 110,858,013 probably benign Het
Psph A C 5: 129,766,468 I174R probably damaging Het
Ptov1 A G 7: 44,865,567 Y207H possibly damaging Het
Ptprs A G 17: 56,434,510 S585P probably damaging Het
Rnf146 A T 10: 29,347,724 H55Q probably damaging Het
Rnf213 T A 11: 119,441,183 M2407K probably damaging Het
Rnls A C 19: 33,202,531 L55R possibly damaging Het
Rptor T C 11: 119,756,320 C246R probably damaging Het
Rrp12 C T 19: 41,877,783 probably null Het
Samd3 A G 10: 26,251,774 D223G probably damaging Het
Sdad1 G A 5: 92,305,296 Q68* probably null Het
Selenov G A 7: 28,290,422 T219M probably damaging Het
Shd A G 17: 55,971,554 D39G possibly damaging Het
Slc26a10 A T 10: 127,178,410 V245E probably damaging Het
Slit1 A G 19: 41,625,573 L820P probably damaging Het
Snap23 T C 2: 120,590,682 F96L probably benign Het
Spert C T 14: 75,583,410 V292I probably benign Het
Stkld1 A G 2: 26,950,103 H395R probably damaging Het
Syt13 G A 2: 92,940,820 G84D probably damaging Het
Terb2 T A 2: 122,186,509 L37Q probably damaging Het
Themis A G 10: 28,781,757 Y107C probably damaging Het
Top2a T A 11: 99,016,069 T249S probably benign Het
Tspo2 A T 17: 48,449,120 F71Y probably damaging Het
Ttc21b T A 2: 66,223,577 K753* probably null Het
Ttk A G 9: 83,854,862 Y458C possibly damaging Het
Ttn T C 2: 76,755,673 R21905G probably damaging Het
Ugt3a2 T A 15: 9,351,168 F88I probably benign Het
Vmn1r119 A G 7: 21,012,196 L87P probably damaging Het
Vmn1r36 A G 6: 66,716,763 F6L probably benign Het
Vmn2r15 T A 5: 109,286,994 K615* probably null Het
Wdr18 G A 10: 79,966,727 probably null Het
Wdr6 A T 9: 108,575,977 W236R probably damaging Het
Zbtb48 T C 4: 152,026,498 T187A probably benign Het
Other mutations in Hdac7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Hdac7 APN 15 97809495 missense probably damaging 0.98
IGL01011:Hdac7 APN 15 97793935 missense possibly damaging 0.83
IGL01361:Hdac7 APN 15 97811442 missense possibly damaging 0.85
IGL01474:Hdac7 APN 15 97797939 critical splice donor site probably null
IGL02314:Hdac7 APN 15 97809004 missense probably damaging 1.00
IGL02379:Hdac7 APN 15 97808385 missense probably damaging 0.99
IGL02665:Hdac7 APN 15 97796957 unclassified probably benign
IGL03010:Hdac7 APN 15 97793929 critical splice donor site probably null
IGL03023:Hdac7 APN 15 97797957 missense probably damaging 1.00
IGL03081:Hdac7 APN 15 97798306 missense probably damaging 1.00
Cairn UTSW 15 97808495 frame shift probably null
Signpost UTSW 15 97802747 missense probably damaging 1.00
R0285:Hdac7 UTSW 15 97798222 critical splice donor site probably null
R0518:Hdac7 UTSW 15 97806499 nonsense probably null
R0521:Hdac7 UTSW 15 97806499 nonsense probably null
R0522:Hdac7 UTSW 15 97806679 splice site probably null
R1543:Hdac7 UTSW 15 97809529 splice site probably benign
R1623:Hdac7 UTSW 15 97808404 nonsense probably null
R1665:Hdac7 UTSW 15 97806525 missense probably damaging 1.00
R1895:Hdac7 UTSW 15 97796886 missense probably damaging 1.00
R1975:Hdac7 UTSW 15 97806505 nonsense probably null
R1976:Hdac7 UTSW 15 97806505 nonsense probably null
R2038:Hdac7 UTSW 15 97798270 missense probably damaging 1.00
R2155:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2156:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2263:Hdac7 UTSW 15 97810851 critical splice donor site probably null
R3546:Hdac7 UTSW 15 97808009 missense probably damaging 1.00
R4438:Hdac7 UTSW 15 97807715 missense probably damaging 1.00
R4642:Hdac7 UTSW 15 97806516 missense probably damaging 1.00
R4704:Hdac7 UTSW 15 97796216 missense probably damaging 1.00
R4705:Hdac7 UTSW 15 97811587 missense probably damaging 0.99
R5303:Hdac7 UTSW 15 97798018 missense probably damaging 0.97
R5577:Hdac7 UTSW 15 97811455 missense probably benign 0.09
R5966:Hdac7 UTSW 15 97802491 missense probably damaging 1.00
R5974:Hdac7 UTSW 15 97802072 splice site probably null
R6270:Hdac7 UTSW 15 97808495 frame shift probably null
R6384:Hdac7 UTSW 15 97811506 nonsense probably null
R6835:Hdac7 UTSW 15 97802747 missense probably damaging 1.00
R6869:Hdac7 UTSW 15 97796176 missense probably damaging 1.00
R7261:Hdac7 UTSW 15 97806534 missense probably benign
R7338:Hdac7 UTSW 15 97810022 missense probably benign 0.30
X0028:Hdac7 UTSW 15 97809008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCGCCATAGGTCCCACTC -3'
(R):5'- AACTCCTTGCCAAGCCTTGC -3'

Sequencing Primer
(F):5'- TCAGCCGAGGGTATCTGTC -3'
(R):5'- GCCAAGCCTTGCCTCTG -3'
Posted On2014-06-23