Incidental Mutation 'R0116:Col6a3'
ID20763
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Namecollagen, type VI, alpha 3
SynonymsCol6a-3
MMRRC Submission 038402-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0116 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location90765923-90843971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90813551 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 720 (S720P)
Ref Sequence ENSEMBL: ENSMUSP00000057131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]
PDB Structure
Crystal structure of the Collagen VI alpha3 N5 domain [X-RAY DIFFRACTION]
Crystal structure of the Collagen VI alpha3 N5 domain R1061Q [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056925
AA Change: S720P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: S720P

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097653
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130846
AA Change: S720P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: S720P

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188587
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 94% (95/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,290,770 V152E probably damaging Het
Abca5 T G 11: 110,276,505 E1495A probably damaging Het
Abcc12 G A 8: 86,534,998 S668F probably benign Het
Adgrl4 A T 3: 151,517,610 T608S probably benign Het
Angel2 G A 1: 190,940,990 D255N probably benign Het
Apob T A 12: 7,989,113 probably benign Het
Arfgef2 A T 2: 166,873,683 R1349S probably damaging Het
Atp2b2 C T 6: 113,793,695 V418I probably damaging Het
Birc6 C A 17: 74,623,746 probably benign Het
Capn13 T A 17: 73,351,524 Y183F probably damaging Het
Cngb1 A G 8: 95,260,638 S352P probably damaging Het
Cpa4 C T 6: 30,579,658 R155W probably damaging Het
Dapk1 A G 13: 60,761,100 I1176V probably benign Het
Dnah17 T C 11: 118,058,306 E2959G probably benign Het
Dnah7b T A 1: 46,213,360 I1734N possibly damaging Het
Dnajb7 A G 15: 81,407,354 Y261H probably benign Het
Dock2 T C 11: 34,688,565 probably benign Het
Dusp27 A C 1: 166,099,701 S781A probably benign Het
Dyrk3 A T 1: 131,129,839 V199E probably damaging Het
F2r G T 13: 95,604,486 C180* probably null Het
F5 A G 1: 164,184,914 S466G probably benign Het
Fbn2 A T 18: 58,102,373 C677* probably null Het
Fbxo41 A G 6: 85,477,908 S673P probably damaging Het
Fhad1 G T 4: 141,940,095 H639N probably benign Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Foxa2 A G 2: 148,043,561 S270P probably damaging Het
Fxyd7 C T 7: 31,047,368 probably null Het
Gm5225 A G 17: 24,024,058 D67G probably benign Het
Grik3 G A 4: 125,670,556 E444K probably benign Het
Gsdma2 A G 11: 98,649,183 K44E probably damaging Het
Haus1 T A 18: 77,762,070 K130* probably null Het
Heg1 A G 16: 33,735,658 probably benign Het
Hormad2 A G 11: 4,412,206 probably benign Het
Hsd17b3 G A 13: 64,058,589 R300C possibly damaging Het
Irf5 T C 6: 29,536,109 F374S probably damaging Het
Itch A G 2: 155,217,983 probably benign Het
Jade2 A T 11: 51,831,309 L139Q probably damaging Het
Kif5c G A 2: 49,752,239 probably benign Het
Lama1 T C 17: 67,776,923 Y1387H probably benign Het
Larp4b A G 13: 9,170,688 R658G probably damaging Het
Mcph1 C T 8: 18,788,248 L729F probably benign Het
Me1 A T 9: 86,654,667 N118K probably benign Het
Med13 A G 11: 86,319,897 L473S probably damaging Het
Mgam T A 6: 40,658,987 Y359N probably damaging Het
Morc2b A G 17: 33,137,041 S586P probably damaging Het
Mthfr A G 4: 148,051,523 D310G probably benign Het
Mtmr7 A T 8: 40,581,405 probably benign Het
Mtus1 A G 8: 40,998,477 probably benign Het
Mus81 G T 19: 5,486,524 A138D probably damaging Het
Myom2 A T 8: 15,117,633 I1073F probably damaging Het
Nhsl1 A T 10: 18,525,242 K739* probably null Het
Nlrp4d T A 7: 10,374,891 K762N probably benign Het
Nrap T C 19: 56,355,546 Y724C probably damaging Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr805 T A 10: 129,722,977 D189V probably damaging Het
Olfr923 T C 9: 38,828,564 L291P probably damaging Het
Olfr948 A T 9: 39,318,864 I250N probably damaging Het
Padi2 T C 4: 140,926,239 V180A probably benign Het
Papss2 C T 19: 32,638,368 R167* probably null Het
Pcbp2 T C 15: 102,474,235 probably benign Het
Per1 T A 11: 69,101,880 probably benign Het
Pik3ca T C 3: 32,459,945 I860T probably damaging Het
Pkdrej G A 15: 85,817,545 Q1397* probably null Het
Plce1 T C 19: 38,721,821 V1133A probably benign Het
Pnmal1 T G 7: 16,960,700 V160G probably damaging Het
Prss12 T C 3: 123,482,774 C351R probably damaging Het
Qprt A T 7: 127,109,097 L54Q probably damaging Het
Raf1 C T 6: 115,626,383 S165N probably damaging Het
Rere A G 4: 150,616,976 N1271S probably benign Het
Rnasel T A 1: 153,754,512 L258H probably damaging Het
Ryr2 T C 13: 11,709,921 D2502G probably damaging Het
Ryr3 G A 2: 112,803,165 S2081L probably damaging Het
Sc5d G T 9: 42,259,859 Y11* probably null Het
Slc25a29 A C 12: 108,827,091 L187R possibly damaging Het
Slc2a7 G A 4: 150,168,264 V454M probably benign Het
Slco1b2 A T 6: 141,669,388 T340S probably benign Het
Smarcc1 A G 9: 110,147,104 N153S possibly damaging Het
Snx1 C A 9: 66,088,539 E516* probably null Het
Sptlc2 T C 12: 87,356,680 D115G probably benign Het
Stard9 A G 2: 120,634,255 N67S probably damaging Het
Swap70 G A 7: 110,273,282 R368H probably benign Het
Tcaf3 T C 6: 42,591,350 K691E probably benign Het
Tmco4 T C 4: 139,053,920 F465S probably damaging Het
Tmem245 A G 4: 56,926,213 S290P probably benign Het
Top2a T C 11: 99,003,590 T972A probably benign Het
Tpr T A 1: 150,410,147 S527R probably damaging Het
Traf2 T C 2: 25,519,609 D443G probably damaging Het
Trim40 A T 17: 36,883,147 probably null Het
Trim42 A T 9: 97,363,403 I448N possibly damaging Het
Ttll9 G A 2: 152,983,134 V78M probably damaging Het
Vav1 C T 17: 57,296,039 L88F probably damaging Het
Vps13b A G 15: 35,423,155 D207G probably damaging Het
Wdsub1 A G 2: 59,876,665 probably null Het
Zfp799 A G 17: 32,821,035 W85R possibly damaging Het
Zfp839 A T 12: 110,858,769 probably benign Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90828255 missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90782026 missense unknown
IGL00541:Col6a3 APN 1 90802142 missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90802332 missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90803933 missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90807510 missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90802292 missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90802514 missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90779162 missense unknown
IGL01827:Col6a3 APN 1 90802319 missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90796571 missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90773048 missense unknown
IGL01900:Col6a3 APN 1 90795010 critical splice donor site probably null
IGL01925:Col6a3 APN 1 90802236 missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90782136 splice site probably benign
IGL02115:Col6a3 APN 1 90807651 missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90781760 missense unknown
IGL02313:Col6a3 APN 1 90811606 missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90779197 missense unknown
IGL02821:Col6a3 APN 1 90803878 missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90796559 missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90811520 nonsense probably null
IGL03129:Col6a3 APN 1 90821862 missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90803893 missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90827866 missense probably benign 0.33
IGL03251:Col6a3 APN 1 90810176 missense probably damaging 1.00
noodloid UTSW 1 90779289 missense unknown
stringy UTSW 1 90803678 nonsense probably null
ANU05:Col6a3 UTSW 1 90802292 missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90810248 missense possibly damaging 0.58
PIT4810001:Col6a3 UTSW 1 90778794 missense unknown
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90798161 missense possibly damaging 0.65
R0167:Col6a3 UTSW 1 90798173 missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90807704 missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90828049 missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90788216 missense unknown
R0512:Col6a3 UTSW 1 90821798 intron probably benign
R0564:Col6a3 UTSW 1 90807734 missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90808086 splice site probably null
R0667:Col6a3 UTSW 1 90828101 missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90778981 missense unknown
R0736:Col6a3 UTSW 1 90804089 missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90828298 missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90802653 missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90794325 missense probably null 1.00
R1169:Col6a3 UTSW 1 90822014 missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90781855 missense unknown
R1225:Col6a3 UTSW 1 90811516 missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90768347 missense unknown
R1387:Col6a3 UTSW 1 90822416 intron probably benign
R1437:Col6a3 UTSW 1 90801376 missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90781855 missense unknown
R1677:Col6a3 UTSW 1 90821861 missense probably benign 0.14
R1681:Col6a3 UTSW 1 90773502 missense unknown
R1711:Col6a3 UTSW 1 90830213 missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90796574 critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90779059 missense unknown
R1738:Col6a3 UTSW 1 90816361 missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90813794 missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90827949 missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90830214 missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1895:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1908:Col6a3 UTSW 1 90811699 missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90822359 missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90804175 missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90782011 missense unknown
R2121:Col6a3 UTSW 1 90810365 missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90803745 missense probably benign 0.09
R2448:Col6a3 UTSW 1 90813358 missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90803713 missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90775599 missense unknown
R3052:Col6a3 UTSW 1 90802130 missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3419:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3837:Col6a3 UTSW 1 90780081 missense unknown
R4007:Col6a3 UTSW 1 90802569 missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90821883 missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90801383 missense probably benign 0.28
R4244:Col6a3 UTSW 1 90786639 missense unknown
R4297:Col6a3 UTSW 1 90811378 missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90822014 missense probably benign 0.23
R4600:Col6a3 UTSW 1 90781904 missense unknown
R4683:Col6a3 UTSW 1 90773457 missense unknown
R4788:Col6a3 UTSW 1 90772950 critical splice donor site probably null
R4851:Col6a3 UTSW 1 90779289 missense unknown
R4899:Col6a3 UTSW 1 90802427 missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90801442 missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90807524 missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90804218 missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90778843 missense unknown
R5057:Col6a3 UTSW 1 90816130 missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90779352 missense unknown
R5105:Col6a3 UTSW 1 90798140 missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90768345 missense unknown
R5166:Col6a3 UTSW 1 90810608 missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90773639 nonsense probably null
R5196:Col6a3 UTSW 1 90816538 splice site probably null
R5230:Col6a3 UTSW 1 90789054 missense unknown
R5268:Col6a3 UTSW 1 90785243 missense unknown
R5381:Col6a3 UTSW 1 90775612 missense unknown
R5392:Col6a3 UTSW 1 90801295 missense probably benign 0.41
R5445:Col6a3 UTSW 1 90782039 nonsense probably null
R5571:Col6a3 UTSW 1 90788216 missense unknown
R5665:Col6a3 UTSW 1 90827880 missense probably benign 0.00
R5902:Col6a3 UTSW 1 90802199 unclassified probably null
R5914:Col6a3 UTSW 1 90776200 missense unknown
R5955:Col6a3 UTSW 1 90811441 missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90821849 missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90768383 missense unknown
R6010:Col6a3 UTSW 1 90773497 missense unknown
R6025:Col6a3 UTSW 1 90828102 missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90813753 missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90773665 missense unknown
R6181:Col6a3 UTSW 1 90816374 missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90822341 missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90822233 missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90810563 missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90781812 missense unknown
R6484:Col6a3 UTSW 1 90791923 critical splice donor site probably null
R6701:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6702:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6724:Col6a3 UTSW 1 90779152 missense unknown
R6746:Col6a3 UTSW 1 90779045 missense unknown
R6797:Col6a3 UTSW 1 90804088 missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90795009 splice site probably null
R6903:Col6a3 UTSW 1 90794207 missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90816002 missense probably benign 0.00
R6978:Col6a3 UTSW 1 90807470 critical splice donor site probably null
R7058:Col6a3 UTSW 1 90828037 nonsense probably null
R7182:Col6a3 UTSW 1 90803678 nonsense probably null
R7294:Col6a3 UTSW 1 90828283 missense probably damaging 1.00
R7296:Col6a3 UTSW 1 90827986 missense probably benign 0.00
R7311:Col6a3 UTSW 1 90822291 missense probably damaging 1.00
R7412:Col6a3 UTSW 1 90828133 missense probably damaging 0.98
R7561:Col6a3 UTSW 1 90775741 missense unknown
X0024:Col6a3 UTSW 1 90803637 critical splice donor site probably null
X0063:Col6a3 UTSW 1 90803905 missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90811529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTCTTCCACAAGTCACAGGCTC -3'
(R):5'- TCCTTTTGGATGGCTCCGACAAC -3'

Sequencing Primer
(F):5'- GGATAGTGGAACTTCCTGTACACC -3'
(R):5'- GTGCGTGACTTTGTAACCAAC -3'
Posted On2013-04-11