Incidental Mutation 'R1845:Nfatc1'
ID207690
Institutional Source Beutler Lab
Gene Symbol Nfatc1
Ensembl Gene ENSMUSG00000033016
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
SynonymsNFATc, NFAT2, 2210017P03Rik, NF-ATc
MMRRC Submission 039870-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1845 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80606205-80713071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80635531 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 881 (K881E)
Ref Sequence ENSEMBL: ENSMUSP00000129001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]
Predicted Effect probably benign
Transcript: ENSMUST00000078049
SMART Domains Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD 429 589 1.3e-27 PFAM
IPT 596 695 8.99e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167977
AA Change: K867E

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016
AA Change: K867E

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 4.9e-28 PFAM
IPT 582 681 8.99e-21 SMART
low complexity region 832 841 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170905
AA Change: K881E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016
AA Change: K881E

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD_DNA_bind 429 589 5.1e-28 PFAM
IPT 596 695 8.99e-21 SMART
low complexity region 846 855 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,332 I142N possibly damaging Het
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Abca17 A T 17: 24,267,716 C1446S probably damaging Het
Asb16 C A 11: 102,276,756 A316E possibly damaging Het
Axdnd1 C T 1: 156,376,544 V384I possibly damaging Het
BC024139 A T 15: 76,125,261 L207* probably null Het
Bcl3 T G 7: 19,809,627 S305R probably damaging Het
Cachd1 T C 4: 100,777,358 V77A probably benign Het
Cd101 C T 3: 101,029,448 probably null Het
Cela1 T C 15: 100,685,167 N64S probably benign Het
Cep128 T C 12: 91,289,598 D366G probably benign Het
Col12a1 A G 9: 79,697,541 V675A probably benign Het
Copg1 A G 6: 87,893,818 Y201C probably damaging Het
Cyp24a1 T C 2: 170,487,917 R372G probably benign Het
Dcaf1 A C 9: 106,851,962 I567L probably benign Het
Dcn A G 10: 97,506,674 D164G probably benign Het
Dnase2a T A 8: 84,909,322 H113Q probably benign Het
Espl1 T C 15: 102,299,013 V304A probably benign Het
Fam193a A G 5: 34,443,372 D315G possibly damaging Het
Fkbp8 T A 8: 70,531,035 probably null Het
Foxp4 T A 17: 47,877,959 T321S probably null Het
Fut10 A G 8: 31,236,300 N361S probably damaging Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gyg A T 3: 20,151,122 V94D probably damaging Het
Has2 T C 15: 56,668,578 K247R probably damaging Het
Helz2 G T 2: 181,232,085 D2205E probably benign Het
Hps6 T A 19: 46,004,970 S449T probably benign Het
Ints10 T C 8: 68,794,671 Y64H probably damaging Het
Kalrn T C 16: 34,356,961 H278R probably damaging Het
Klhdc8a T C 1: 132,303,810 V280A possibly damaging Het
Klk1b5 A G 7: 44,220,125 M210V probably benign Het
Kmt2c G A 5: 25,373,436 A614V probably benign Het
Lck T A 4: 129,558,086 I45F probably benign Het
Lin7a A C 10: 107,412,059 E75A probably damaging Het
Lrp1 A T 10: 127,578,673 C1070S probably damaging Het
Mapk8ip3 G T 17: 24,914,583 N289K probably benign Het
Mbtps1 T C 8: 119,522,493 D686G probably benign Het
Mknk1 T A 4: 115,873,231 C178* probably null Het
Mtmr6 A G 14: 60,296,735 N474S probably damaging Het
Mvb12b A G 2: 33,840,157 probably null Het
Myh6 T C 14: 54,944,674 K1759R probably damaging Het
Nlrp10 A G 7: 108,927,041 F30S probably damaging Het
Nop14 G T 5: 34,650,328 A430E possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1212 A G 2: 88,958,867 I134V probably damaging Het
Olfr347 A T 2: 36,734,842 I174F probably damaging Het
Olfr775 A G 10: 129,250,594 E20G probably benign Het
Olfr794 A T 10: 129,571,348 Q231L probably damaging Het
Olfr829 A T 9: 18,857,486 Y287F possibly damaging Het
Osbpl7 C A 11: 97,059,128 S378R probably damaging Het
Otof A T 5: 30,371,723 Y1775* probably null Het
Parp16 T C 9: 65,215,594 S46P possibly damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pi16 A T 17: 29,319,387 Q58L possibly damaging Het
Pld3 C A 7: 27,539,452 M190I probably benign Het
Plscr4 T G 9: 92,490,046 I290S probably damaging Het
Ppip5k2 T C 1: 97,723,806 D928G possibly damaging Het
Ppp1r13l T A 7: 19,368,611 L15Q probably damaging Het
Ptpn14 C A 1: 189,839,502 S263R possibly damaging Het
Sema7a G A 9: 57,954,899 V178I possibly damaging Het
Sesn2 A T 4: 132,497,070 Y342* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sltm A G 9: 70,543,032 N38S possibly damaging Het
Smg1 T C 7: 118,154,622 probably benign Het
Spsb1 A T 4: 149,906,910 V67E probably damaging Het
Suox A G 10: 128,670,539 V540A possibly damaging Het
Tbc1d12 T A 19: 38,911,085 I483N probably damaging Het
Tbcb A T 7: 30,224,499 D198E possibly damaging Het
Tbce T C 13: 14,019,709 K122E probably benign Het
Tcap T A 11: 98,384,379 L113H probably damaging Het
Thsd7a A T 6: 12,321,041 I1545N probably damaging Het
Tmed10 T C 12: 85,374,503 T55A possibly damaging Het
Tmem268 T A 4: 63,579,943 V200D probably damaging Het
Tmem45b A C 9: 31,431,355 I50M probably damaging Het
Trp53bp2 T C 1: 182,458,903 W1103R probably damaging Het
Ttn C T 2: 76,764,033 V20524M probably damaging Het
Ulk2 A T 11: 61,812,738 N379K probably benign Het
Vmn1r59 A G 7: 5,454,554 V69A probably benign Het
Vmn2r10 A T 5: 109,001,995 Y394* probably null Het
Zfp212 T C 6: 47,931,541 S485P probably benign Het
Zfp512b A T 2: 181,585,735 C776S probably damaging Het
Zfp518b A G 5: 38,671,741 Y974H probably damaging Het
Other mutations in Nfatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Nfatc1 APN 18 80667026 missense probably damaging 1.00
IGL00742:Nfatc1 APN 18 80698014 missense probably benign 0.20
IGL01510:Nfatc1 APN 18 80698188 missense probably damaging 1.00
IGL01790:Nfatc1 APN 18 80667042 missense probably damaging 1.00
IGL02548:Nfatc1 APN 18 80697898 missense probably damaging 1.00
goldfeld UTSW 18 80697832 missense probably damaging 0.99
R0019:Nfatc1 UTSW 18 80635504 missense probably benign
R0411:Nfatc1 UTSW 18 80698042 missense possibly damaging 0.88
R0738:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R0940:Nfatc1 UTSW 18 80635895 missense probably benign 0.03
R1458:Nfatc1 UTSW 18 80665267 splice site probably benign
R1622:Nfatc1 UTSW 18 80666967 missense probably damaging 1.00
R2110:Nfatc1 UTSW 18 80635664 nonsense probably null
R2112:Nfatc1 UTSW 18 80635664 nonsense probably null
R2157:Nfatc1 UTSW 18 80635845 missense possibly damaging 0.88
R3857:Nfatc1 UTSW 18 80665275 splice site probably benign
R3859:Nfatc1 UTSW 18 80665275 splice site probably benign
R4108:Nfatc1 UTSW 18 80698368 missense possibly damaging 0.68
R4510:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4511:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4618:Nfatc1 UTSW 18 80697832 missense probably damaging 0.99
R4850:Nfatc1 UTSW 18 80697865 missense probably benign 0.30
R5329:Nfatc1 UTSW 18 80708117 start codon destroyed probably null
R5395:Nfatc1 UTSW 18 80636020 missense possibly damaging 0.80
R5468:Nfatc1 UTSW 18 80649855 missense probably benign 0.00
R5522:Nfatc1 UTSW 18 80653529 missense probably benign 0.36
R5568:Nfatc1 UTSW 18 80649822 missense probably benign 0.12
R6111:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R6190:Nfatc1 UTSW 18 80712670 missense probably benign 0.21
R6397:Nfatc1 UTSW 18 80635941 missense probably damaging 1.00
R6943:Nfatc1 UTSW 18 80635555 missense probably damaging 1.00
R6970:Nfatc1 UTSW 18 80667013 missense probably benign 0.34
X0062:Nfatc1 UTSW 18 80697618 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CAACTCAATGGCTGTGCAC -3'
(R):5'- GTGGTCACCTTGGACTTCAG -3'

Sequencing Primer
(F):5'- AATGGCTGTGCACACACCG -3'
(R):5'- TTGGACTTCAGCCACCCG -3'
Posted On2014-06-23