Incidental Mutation 'R1846:Usp4'
List |< first << previous [record 64 of 72] next >> last >|
ID207737
Institutional Source Beutler Lab
Gene Symbol Usp4
Ensembl Gene ENSMUSG00000032612
Gene Nameubiquitin specific peptidase 4 (proto-oncogene)
SynonymsF730026I20Rik, Unp
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108347853-108392545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108372736 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 441 (I441V)
Ref Sequence ENSEMBL: ENSMUSP00000141368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035237] [ENSMUST00000194224] [ENSMUST00000194959]
Predicted Effect probably benign
Transcript: ENSMUST00000035237
AA Change: I488V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035237
Gene: ENSMUSG00000032612
AA Change: I488V

DomainStartEndE-ValueType
DUSP 27 125 1.39e-46 SMART
Pfam:Ubiquitin_3 139 226 6.7e-34 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 919 2.2e-84 PFAM
Pfam:UCH_1 302 507 2.8e-8 PFAM
Pfam:UCH_1 605 901 1.4e-15 PFAM
low complexity region 927 938 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193288
AA Change: I15V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194065
Predicted Effect probably benign
Transcript: ENSMUST00000194224
AA Change: I488V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141321
Gene: ENSMUSG00000032612
AA Change: I488V

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.3e-30 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 633 1.4e-50 PFAM
Pfam:UCH_1 302 520 2.3e-8 PFAM
low complexity region 657 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194959
AA Change: I441V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141368
Gene: ENSMUSG00000032612
AA Change: I441V

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.7e-30 PFAM
Pfam:UCH 254 872 7e-89 PFAM
Pfam:UCH_1 255 469 3.5e-8 PFAM
Pfam:UCH_1 566 854 2.5e-14 PFAM
low complexity region 880 891 N/A INTRINSIC
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased irradiation-induced apoptosis, slow cellular growth, resistance to oncogenic transformation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r115 A C 17: 23,359,383 K610T probably damaging Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Usp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Usp4 APN 9 108362900 critical splice donor site probably null
IGL01663:Usp4 APN 9 108365880 missense possibly damaging 0.80
IGL02105:Usp4 APN 9 108384932 missense probably damaging 1.00
IGL02486:Usp4 APN 9 108351029 missense probably damaging 1.00
R0148:Usp4 UTSW 9 108391671 splice site probably null
R0285:Usp4 UTSW 9 108378564 missense probably benign 0.33
R0591:Usp4 UTSW 9 108348029 splice site probably benign
R0594:Usp4 UTSW 9 108370881 intron probably null
R0616:Usp4 UTSW 9 108366804 missense probably benign
R1329:Usp4 UTSW 9 108372566 missense probably damaging 1.00
R1508:Usp4 UTSW 9 108372674 missense probably benign 0.14
R1752:Usp4 UTSW 9 108374242 missense probably damaging 1.00
R1824:Usp4 UTSW 9 108348008 missense probably damaging 1.00
R2196:Usp4 UTSW 9 108373686 missense probably benign 0.07
R2925:Usp4 UTSW 9 108367856 missense probably damaging 1.00
R4126:Usp4 UTSW 9 108360117 missense probably benign 0.10
R4345:Usp4 UTSW 9 108368023 intron probably benign
R4965:Usp4 UTSW 9 108362620 missense probably damaging 1.00
R4981:Usp4 UTSW 9 108381418 missense probably benign 0.00
R5110:Usp4 UTSW 9 108362678 missense probably damaging 1.00
R5580:Usp4 UTSW 9 108365859 missense probably benign 0.09
R5586:Usp4 UTSW 9 108356462 missense possibly damaging 0.95
R5927:Usp4 UTSW 9 108391760 missense probably benign 0.09
R6025:Usp4 UTSW 9 108360123 missense possibly damaging 0.70
R6112:Usp4 UTSW 9 108356504 missense probably damaging 1.00
R6197:Usp4 UTSW 9 108370955 missense probably damaging 1.00
R6742:Usp4 UTSW 9 108374239 missense possibly damaging 0.74
X0026:Usp4 UTSW 9 108347870 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GACAGATGTTGCGAATCTCCC -3'
(R):5'- TGCACATAGAGACTTAAGCCC -3'

Sequencing Primer
(F):5'- GATGTTGCGAATCTCCCTACTTAATC -3'
(R):5'- CACATAGAGACTTAAGCCCAAGGG -3'
Posted On2014-06-23