Incidental Mutation 'R1846:Vmn2r115'
ID207760
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Namevomeronasal 2, receptor 115
SynonymsEG638102
MMRRC Submission 039871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1846 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23343977-23360128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23359383 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 610 (K610T)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
Predicted Effect probably damaging
Transcript: ENSMUST00000168175
AA Change: K610T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: K610T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Meta Mutation Damage Score 0.0396 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,235,963 L102I probably damaging Het
2900092C05Rik G A 7: 12,512,882 R63Q probably benign Het
Adamts20 A T 15: 94,345,990 C619S probably damaging Het
Alx1 T C 10: 103,025,304 D121G possibly damaging Het
Anks3 A C 16: 4,953,884 M215R probably benign Het
Anxa4 T A 6: 86,741,911 probably null Het
Arhgef25 A G 10: 127,185,864 V222A probably damaging Het
Bglap2 A G 3: 88,378,625 probably benign Het
Cars2 A G 8: 11,514,674 V22A probably benign Het
Cenpe T A 3: 135,239,845 I1040N probably damaging Het
Cep170 C T 1: 176,755,769 D1015N probably damaging Het
Chia1 T A 3: 106,130,865 I359N probably damaging Het
Crot A T 5: 8,988,248 V93E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnmbp T C 19: 43,902,747 I194V probably damaging Het
Dock4 T A 12: 40,733,268 C734S probably benign Het
Eif4e3 T C 6: 99,640,701 S70G probably benign Het
Entpd3 G A 9: 120,558,375 D213N probably benign Het
Ern2 T G 7: 122,176,536 Y445S probably benign Het
Fasn A G 11: 120,813,307 S1429P probably benign Het
Fat4 A G 3: 38,982,383 I3395V probably benign Het
Fbln2 C A 6: 91,256,417 Q628K possibly damaging Het
Fbxo28 T C 1: 182,326,280 N164D probably benign Het
Fez1 T C 9: 36,867,767 S247P probably damaging Het
Gars A G 6: 55,063,168 D360G probably benign Het
Gcfc2 A T 6: 81,956,892 Q710L probably damaging Het
Ggt5 A G 10: 75,610,542 probably null Het
Glp1r A G 17: 30,929,935 probably null Het
Hspa14 T C 2: 3,491,660 D356G possibly damaging Het
Htt T A 5: 34,848,944 I1399N probably damaging Het
Kmt2e G A 5: 23,499,486 probably benign Het
Krt36 C A 11: 100,105,548 G17C probably damaging Het
Lama2 T C 10: 27,212,096 E895G probably damaging Het
Lamb2 G A 9: 108,487,387 R1142H probably benign Het
Lhcgr C T 17: 88,765,147 probably null Het
Lpin2 A G 17: 71,225,069 T140A probably benign Het
Metap1 A G 3: 138,480,682 probably benign Het
Mpeg1 T C 19: 12,463,122 V648A probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc4 T A 16: 32,752,369 I749N probably benign Het
N4bp2 T C 5: 65,808,519 F1304L probably damaging Het
Nup85 A G 11: 115,568,413 E114G probably benign Het
Olfr1258 A G 2: 89,930,666 T286A possibly damaging Het
Olfr1415 A T 1: 92,491,100 Y218* probably null Het
Olfr448 A G 6: 42,897,320 S290G probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Parp2 T A 14: 50,815,386 C145* probably null Het
Plpp6 T C 19: 28,964,280 S94P probably benign Het
Polr1a T C 6: 71,976,188 I1580T probably damaging Het
Polrmt A T 10: 79,738,209 V860E probably damaging Het
Ppp1r17 A G 6: 56,022,427 E15G possibly damaging Het
Prl7b1 A T 13: 27,602,848 W133R probably damaging Het
Ptk7 A G 17: 46,576,490 probably null Het
Rad23b C T 4: 55,383,637 Q290* probably null Het
Rorb C T 19: 18,955,081 E369K probably damaging Het
Rusc1 T C 3: 89,092,145 D110G probably damaging Het
Smg7 A G 1: 152,848,850 S527P probably damaging Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Stt3a C T 9: 36,763,385 R34H probably damaging Het
Sufu T A 19: 46,450,947 I202N possibly damaging Het
Thsd7b G A 1: 129,613,256 R289Q probably damaging Het
Tph1 A T 7: 46,660,439 S130T probably damaging Het
Ttn A G 2: 76,945,686 S1671P probably damaging Het
Usp4 A G 9: 108,372,736 I441V probably benign Het
Vmn1r8 A G 6: 57,036,428 N155D probably benign Het
Vmn2r62 G A 7: 42,789,122 P97S probably damaging Het
Zbtb40 T C 4: 137,007,839 D297G probably benign Het
Zfp174 C A 16: 3,854,735 Q383K probably benign Het
Zfp318 T A 17: 46,413,666 D2198E probably benign Het
Zfp628 C T 7: 4,920,867 P696L possibly damaging Het
Zgrf1 T A 3: 127,615,463 N1695K probably damaging Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23346278 missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1420:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23345172 missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23345333 missense probably benign
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23346029 missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23357009 missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23359598 missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCCCATTAGATGTGGATTATTGTGTC -3'
(R):5'- GGCTATGATTTTGAATGCCAGAAC -3'

Sequencing Primer
(F):5'- AGATGTGGATTATTGTGTCCAGTGTC -3'
(R):5'- ATCGTTTTAGCCAAGACAGTGG -3'
Posted On2014-06-23