Incidental Mutation 'R1847:Magi2'
ID207792
Institutional Source Beutler Lab
Gene Symbol Magi2
Ensembl Gene ENSMUSG00000040003
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 2
SynonymsMagi-2, S-SCAM, Acvrinp1
MMRRC Submission 039872-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1847 (G1)
Quality Score198
Status Validated
Chromosome5
Chromosomal Location19227036-20704792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20602460 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 871 (N871Y)
Ref Sequence ENSEMBL: ENSMUSP00000099094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088516] [ENSMUST00000101558] [ENSMUST00000115267] [ENSMUST00000197354] [ENSMUST00000197443] [ENSMUST00000197553] [ENSMUST00000208219]
Predicted Effect probably benign
Transcript: ENSMUST00000088516
AA Change: N1048Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085872
Gene: ENSMUSG00000040003
AA Change: N1048Y

DomainStartEndE-ValueType
PDZ 26 101 5.26e-9 SMART
GuKc 107 290 2.76e-45 SMART
WW 302 334 7.43e-12 SMART
WW 348 380 2.4e-6 SMART
PDZ 433 509 3.51e-19 SMART
PDZ 612 682 2.3e-14 SMART
PDZ 785 861 4.04e-19 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 5.05e-20 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 3.88e-21 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101558
AA Change: N871Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099094
Gene: ENSMUSG00000040003
AA Change: N871Y

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 608 684 4.04e-19 SMART
low complexity region 716 730 N/A INTRINSIC
PDZ 751 832 5.05e-20 SMART
low complexity region 875 886 N/A INTRINSIC
PDZ 970 1044 3.88e-21 SMART
low complexity region 1080 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115267
AA Change: N885Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110922
Gene: ENSMUSG00000040003
AA Change: N885Y

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 622 698 4.04e-19 SMART
low complexity region 730 744 N/A INTRINSIC
PDZ 765 846 5.05e-20 SMART
low complexity region 889 900 N/A INTRINSIC
PDZ 984 1058 3.88e-21 SMART
low complexity region 1094 1107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197354
AA Change: N1048Y

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142576
Gene: ENSMUSG00000040003
AA Change: N1048Y

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 785 861 2e-21 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 2.4e-22 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 1.9e-23 SMART
low complexity region 1255 1269 N/A INTRINSIC
low complexity region 1304 1319 N/A INTRINSIC
low complexity region 1344 1363 N/A INTRINSIC
low complexity region 1368 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197443
AA Change: N1034Y

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142764
Gene: ENSMUSG00000040003
AA Change: N1034Y

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 771 847 2e-21 SMART
low complexity region 879 893 N/A INTRINSIC
PDZ 914 995 2.4e-22 SMART
low complexity region 1038 1049 N/A INTRINSIC
PDZ 1133 1207 1.9e-23 SMART
low complexity region 1241 1255 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1354 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197553
AA Change: N658Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198908
Predicted Effect probably benign
Transcript: ENSMUST00000199514
Predicted Effect probably benign
Transcript: ENSMUST00000208219
AA Change: N642Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death and hippocampal neurons with altered dendritic spine morphology. Homozygotes for a different null allele die neonatally due to anuria and podocyte anomalies. Mice lacking all three isoforms develop proteinuria, podocytopathy and die of renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C A 16: 14,445,449 R758S probably benign Het
Acnat1 A T 4: 49,447,716 H288Q possibly damaging Het
Adamts1 T C 16: 85,802,226 E162G possibly damaging Het
Akap11 A G 14: 78,513,661 S429P probably benign Het
Alg14 T C 3: 121,361,766 Y212H probably damaging Het
Cacna1g T C 11: 94,466,181 T97A probably damaging Het
Ccdc112 T A 18: 46,287,754 N310Y possibly damaging Het
Cenpl A T 1: 161,086,004 Y328F probably damaging Het
Cep162 G A 9: 87,204,080 H1064Y probably benign Het
Cnksr3 T A 10: 7,154,324 E126D probably benign Het
Ctsh T A 9: 90,061,565 M81K probably benign Het
D6Wsu163e A G 6: 126,955,149 T284A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnaaf1 T A 8: 119,582,877 M196K probably benign Het
Dnah9 C A 11: 65,834,386 G4314C probably damaging Het
Dph1 A G 11: 75,179,731 Y361H probably damaging Het
Ect2 C T 3: 27,150,072 M29I probably benign Het
Eif3h T C 15: 51,797,670 Y167C probably damaging Het
Epc2 C T 2: 49,532,089 R332C probably damaging Het
Fras1 C A 5: 96,749,423 probably null Het
Gfm2 A G 13: 97,162,934 I386V probably benign Het
Gpd1l G A 9: 114,914,331 T167I probably damaging Het
Hsph1 T A 5: 149,623,485 K567* probably null Het
Igfn1 T G 1: 135,969,388 S1147R probably benign Het
Itgb4 T C 11: 115,983,764 V406A probably benign Het
Kcna2 A G 3: 107,105,113 I337V possibly damaging Het
Kcnab1 T C 3: 65,302,194 probably null Het
Kri1 G T 9: 21,280,492 probably benign Het
Lrguk T A 6: 34,133,387 I801K possibly damaging Het
Map3k10 G T 7: 27,661,556 probably null Het
Mrps25 T C 6: 92,178,740 T71A probably damaging Het
Myo15 G A 11: 60,499,495 W945* probably null Het
Ncan A T 8: 70,102,454 I1021N probably damaging Het
Ncf4 C A 15: 78,250,382 S11R probably benign Het
Neb A C 2: 52,196,295 S5255R possibly damaging Het
Nop2 TGATGAAGATGAAGATGA TGATGAAGATGA 6: 125,137,079 probably benign Het
Olfr1155 T C 2: 87,942,721 probably null Het
Olfr1189 G A 2: 88,592,172 A123T probably damaging Het
Olfr992 A T 2: 85,400,441 F31I probably damaging Het
Pacs1 T C 19: 5,153,714 I328V probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pan2 A G 10: 128,304,378 H56R possibly damaging Het
Pigo G A 4: 43,024,710 R124* probably null Het
Ppfia2 A G 10: 106,927,710 D1188G probably benign Het
Ppp1r16b A G 2: 158,761,435 N327D probably damaging Het
Psd3 A G 8: 67,720,004 C223R possibly damaging Het
Rad50 A G 11: 53,702,107 V72A possibly damaging Het
Rcor3 T A 1: 192,100,833 D445V possibly damaging Het
Rundc1 T A 11: 101,433,681 H404Q probably benign Het
Ryr1 T C 7: 29,079,811 K2083E probably benign Het
Scd3 C A 19: 44,235,842 H171Q probably damaging Het
Scrn2 T C 11: 97,032,195 F155L probably benign Het
Serpina12 A T 12: 104,032,510 L323Q probably damaging Het
Sptlc3 T A 2: 139,625,923 M467K probably benign Het
Stard9 G T 2: 120,698,489 R1742S possibly damaging Het
Thbd A T 2: 148,407,684 L88* probably null Het
Tln2 G A 9: 67,362,687 Q477* probably null Het
Tnn T A 1: 160,116,182 E1020D possibly damaging Het
Trip12 A T 1: 84,749,269 H3Q probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmp1 G A 11: 86,643,587 Q165* probably null Het
Zfp758 T A 17: 22,375,223 M230K probably benign Het
Other mutations in Magi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Magi2 APN 5 20391301 missense probably benign 0.05
IGL02120:Magi2 APN 5 20228453 critical splice donor site probably null
IGL02341:Magi2 APN 5 20466203 missense probably damaging 1.00
IGL02411:Magi2 APN 5 19678709 missense probably damaging 1.00
IGL02657:Magi2 APN 5 19227583 missense probably damaging 0.99
IGL02976:Magi2 APN 5 20534475 missense probably damaging 1.00
IGL03105:Magi2 APN 5 20543618 missense probably damaging 0.97
IGL03246:Magi2 APN 5 20358950 missense probably damaging 1.00
IGL03329:Magi2 APN 5 20466128 missense possibly damaging 0.95
LCD18:Magi2 UTSW 5 19954511 intron probably benign
PIT4519001:Magi2 UTSW 5 20661346 missense probably damaging 1.00
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0352:Magi2 UTSW 5 20065666 missense probably damaging 1.00
R0362:Magi2 UTSW 5 19227575 missense probably damaging 1.00
R0496:Magi2 UTSW 5 20661359 splice site probably benign
R1103:Magi2 UTSW 5 20611103 missense probably damaging 1.00
R1435:Magi2 UTSW 5 20358945 missense probably damaging 1.00
R1583:Magi2 UTSW 5 19227332 missense probably benign 0.30
R1616:Magi2 UTSW 5 20609326 missense probably damaging 1.00
R1643:Magi2 UTSW 5 20705506 unclassified probably benign
R1707:Magi2 UTSW 5 20215493 missense probably damaging 1.00
R1833:Magi2 UTSW 5 19227457 missense probably damaging 1.00
R1837:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1838:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1839:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R2223:Magi2 UTSW 5 20465672 missense probably damaging 1.00
R2496:Magi2 UTSW 5 19678752 missense probably benign 0.42
R2504:Magi2 UTSW 5 20358936 missense probably damaging 1.00
R2848:Magi2 UTSW 5 20602461 frame shift probably null
R2879:Magi2 UTSW 5 20602461 frame shift probably null
R2935:Magi2 UTSW 5 20602461 frame shift probably null
R2936:Magi2 UTSW 5 20602461 frame shift probably null
R3694:Magi2 UTSW 5 20602461 frame shift probably null
R3783:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3786:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3787:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3837:Magi2 UTSW 5 20215468 missense probably benign 0.28
R4151:Magi2 UTSW 5 19227292 missense probably damaging 0.97
R4721:Magi2 UTSW 5 20534469 missense probably damaging 1.00
R5005:Magi2 UTSW 5 20534446 missense probably damaging 0.98
R5012:Magi2 UTSW 5 20465620 missense probably damaging 0.99
R5193:Magi2 UTSW 5 20358972 critical splice donor site probably null
R5298:Magi2 UTSW 5 20569162 missense probably damaging 1.00
R5372:Magi2 UTSW 5 20702110 missense possibly damaging 0.82
R5580:Magi2 UTSW 5 20215424 missense probably benign 0.03
R5806:Magi2 UTSW 5 20651204 missense probably benign 0.01
R5924:Magi2 UTSW 5 20611069 missense probably benign 0.00
R5992:Magi2 UTSW 5 19227291 start codon destroyed probably null 0.42
R6014:Magi2 UTSW 5 20611093 missense probably damaging 1.00
R6073:Magi2 UTSW 5 20569288 missense probably damaging 1.00
R6500:Magi2 UTSW 5 20602347 missense possibly damaging 0.94
R6664:Magi2 UTSW 5 20702397 missense probably benign 0.00
R7229:Magi2 UTSW 5 20465588 missense probably damaging 1.00
R7344:Magi2 UTSW 5 20550240 missense probably benign 0.19
R7448:Magi2 UTSW 5 20358956 missense probably damaging 1.00
X0065:Magi2 UTSW 5 20569178 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTAGCCTGCTAGGGAAAAGCC -3'
(R):5'- GAAAATCTCCCTCCCATCTGTG -3'

Sequencing Primer
(F):5'- GCACCAAGTCTCAGCCTCTG -3'
(R):5'- GTGTCCTAAACGGTTCTCAGGAATTC -3'
Posted On2014-06-23