Incidental Mutation 'R1847:Cep162'
ID207808
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission 039872-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R1847 (G1)
Quality Score202
Status Validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87204080 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1064 (H1064Y)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably benign
Transcript: ENSMUST00000093802
AA Change: H1064Y

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: H1064Y

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157106
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C A 16: 14,445,449 R758S probably benign Het
Acnat1 A T 4: 49,447,716 H288Q possibly damaging Het
Adamts1 T C 16: 85,802,226 E162G possibly damaging Het
Akap11 A G 14: 78,513,661 S429P probably benign Het
Alg14 T C 3: 121,361,766 Y212H probably damaging Het
Cacna1g T C 11: 94,466,181 T97A probably damaging Het
Ccdc112 T A 18: 46,287,754 N310Y possibly damaging Het
Cenpl A T 1: 161,086,004 Y328F probably damaging Het
Cnksr3 T A 10: 7,154,324 E126D probably benign Het
Ctsh T A 9: 90,061,565 M81K probably benign Het
D6Wsu163e A G 6: 126,955,149 T284A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnaaf1 T A 8: 119,582,877 M196K probably benign Het
Dnah9 C A 11: 65,834,386 G4314C probably damaging Het
Dph1 A G 11: 75,179,731 Y361H probably damaging Het
Ect2 C T 3: 27,150,072 M29I probably benign Het
Eif3h T C 15: 51,797,670 Y167C probably damaging Het
Epc2 C T 2: 49,532,089 R332C probably damaging Het
Fras1 C A 5: 96,749,423 probably null Het
Gfm2 A G 13: 97,162,934 I386V probably benign Het
Gpd1l G A 9: 114,914,331 T167I probably damaging Het
Hsph1 T A 5: 149,623,485 K567* probably null Het
Igfn1 T G 1: 135,969,388 S1147R probably benign Het
Itgb4 T C 11: 115,983,764 V406A probably benign Het
Kcna2 A G 3: 107,105,113 I337V possibly damaging Het
Kcnab1 T C 3: 65,302,194 probably null Het
Kri1 G T 9: 21,280,492 probably benign Het
Lrguk T A 6: 34,133,387 I801K possibly damaging Het
Magi2 A T 5: 20,602,460 N871Y probably damaging Het
Map3k10 G T 7: 27,661,556 probably null Het
Mrps25 T C 6: 92,178,740 T71A probably damaging Het
Myo15 G A 11: 60,499,495 W945* probably null Het
Ncan A T 8: 70,102,454 I1021N probably damaging Het
Ncf4 C A 15: 78,250,382 S11R probably benign Het
Neb A C 2: 52,196,295 S5255R possibly damaging Het
Nop2 TGATGAAGATGAAGATGA TGATGAAGATGA 6: 125,137,079 probably benign Het
Olfr1155 T C 2: 87,942,721 probably null Het
Olfr1189 G A 2: 88,592,172 A123T probably damaging Het
Olfr992 A T 2: 85,400,441 F31I probably damaging Het
Pacs1 T C 19: 5,153,714 I328V probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pan2 A G 10: 128,304,378 H56R possibly damaging Het
Pigo G A 4: 43,024,710 R124* probably null Het
Ppfia2 A G 10: 106,927,710 D1188G probably benign Het
Ppp1r16b A G 2: 158,761,435 N327D probably damaging Het
Psd3 A G 8: 67,720,004 C223R possibly damaging Het
Rad50 A G 11: 53,702,107 V72A possibly damaging Het
Rcor3 T A 1: 192,100,833 D445V possibly damaging Het
Rundc1 T A 11: 101,433,681 H404Q probably benign Het
Ryr1 T C 7: 29,079,811 K2083E probably benign Het
Scd3 C A 19: 44,235,842 H171Q probably damaging Het
Scrn2 T C 11: 97,032,195 F155L probably benign Het
Serpina12 A T 12: 104,032,510 L323Q probably damaging Het
Sptlc3 T A 2: 139,625,923 M467K probably benign Het
Stard9 G T 2: 120,698,489 R1742S possibly damaging Het
Thbd A T 2: 148,407,684 L88* probably null Het
Tln2 G A 9: 67,362,687 Q477* probably null Het
Tnn T A 1: 160,116,182 E1020D possibly damaging Het
Trip12 A T 1: 84,749,269 H3Q probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmp1 G A 11: 86,643,587 Q165* probably null Het
Zfp758 T A 17: 22,375,223 M230K probably benign Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGCCTCGACAGCATCATC -3'
(R):5'- TCTTTCCTCAGATTCAGTACGAAC -3'

Sequencing Primer
(F):5'- TCGACAGCATCATCCTTCTC -3'
(R):5'- TTCAGTACGAACAGCGGC -3'
Posted On2014-06-23