Incidental Mutation 'R1848:Abcc8'
ID207889
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission 039873-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R1848 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46166902 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 271 (D271E)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123]
Predicted Effect probably benign
Transcript: ENSMUST00000033123
AA Change: D271E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: D271E

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210986
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 87,568,493 Y86* probably null Het
Aadac A G 3: 60,039,697 E272G probably damaging Het
Acan T C 7: 79,099,035 F1185L probably benign Het
Adam1a A T 5: 121,519,620 C537S probably damaging Het
Ago2 A G 15: 73,123,965 V395A probably benign Het
Alox15 A G 11: 70,350,752 V101A probably damaging Het
Ankra2 T C 13: 98,271,124 I194T probably damaging Het
Apobec4 C A 1: 152,756,230 P3H probably damaging Het
Arid3b G T 9: 57,796,677 Y329* probably null Het
Atm A T 9: 53,468,012 S1993T probably benign Het
Bpgm T G 6: 34,487,734 S129A probably benign Het
Brat1 A G 5: 140,718,509 D839G possibly damaging Het
Ccdc15 A T 9: 37,342,570 S128T probably benign Het
Cd300lg A T 11: 102,046,206 probably benign Het
Cdc34b C A 11: 94,742,477 Q168K probably damaging Het
Celsr2 A T 3: 108,401,310 V1767E probably benign Het
Cep350 T C 1: 155,953,651 D169G probably benign Het
Col7a1 A T 9: 108,969,565 D1762V possibly damaging Het
Coro7 A G 16: 4,630,434 L724P probably damaging Het
Crb1 T A 1: 139,237,012 I1125F probably damaging Het
Ctif T A 18: 75,519,941 D415V probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs2 A G 14: 55,240,841 D237G probably benign Het
Dhx9 T C 1: 153,465,753 Q582R probably damaging Het
Dnajc1 C T 2: 18,219,713 R443Q probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dpf2 C A 19: 5,906,615 Q70H probably damaging Het
Dqx1 T A 6: 83,066,107 D608E probably damaging Het
Dync2h1 T A 9: 7,049,166 T3245S probably benign Het
Ect2l A G 10: 18,200,033 L35P probably damaging Het
Efcab5 A T 11: 77,103,306 L1285Q probably damaging Het
Eif4g1 G C 16: 20,681,867 R697P probably damaging Het
Emsy T A 7: 98,600,821 E753V probably damaging Het
Entpd3 A G 9: 120,558,419 I227M probably damaging Het
Epn1 T A 7: 5,089,998 V103E probably damaging Het
Esrra T C 19: 6,912,010 D337G probably benign Het
Fam129c T C 8: 71,603,769 M371T possibly damaging Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fat2 A G 11: 55,311,558 I230T probably damaging Het
Fbxl16 A G 17: 25,816,446 I6V probably benign Het
Fgf23 T C 6: 127,073,193 I55T probably damaging Het
Fibcd1 T A 2: 31,821,549 D288V probably damaging Het
Flnb T C 14: 7,892,113 I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 E449G probably benign Het
Gbf1 T G 19: 46,272,037 S1130A possibly damaging Het
Gipc3 T C 10: 81,341,265 E157G probably damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm6625 A C 8: 89,146,834 noncoding transcript Het
Gpx4 A G 10: 80,056,036 probably benign Het
Grb10 A G 11: 11,946,029 F264L possibly damaging Het
Grik3 T C 4: 125,694,138 Y684H probably damaging Het
Gstp1 C T 19: 4,036,795 probably benign Het
Haus8 G A 8: 71,256,123 probably benign Het
Hip1 G A 5: 135,435,141 probably null Het
Hist3h2ba A T 11: 58,949,102 I55F possibly damaging Het
Hspbap1 T A 16: 35,818,764 probably null Het
Htr2b T A 1: 86,099,429 I452F possibly damaging Het
Hydin T A 8: 110,569,808 H3656Q probably benign Het
Klb T A 5: 65,348,837 D142E probably benign Het
Lamb3 A T 1: 193,334,616 T777S possibly damaging Het
Lins1 C A 7: 66,714,322 T650K probably damaging Het
Loxhd1 A G 18: 77,281,971 K5R possibly damaging Het
Lpp G A 16: 24,761,655 M40I probably damaging Het
Mia2 A T 12: 59,170,251 probably benign Het
Miip A C 4: 147,863,092 F204V probably damaging Het
Mmp21 T C 7: 133,677,153 R323G probably benign Het
Mta3 T A 17: 83,755,551 probably benign Het
Myh1 A G 11: 67,213,630 K1004R probably benign Het
Myh14 T A 7: 44,632,429 I810F probably damaging Het
Nbas A C 12: 13,413,597 D1295A probably damaging Het
Npr2 T G 4: 43,632,384 V67G probably benign Het
Oas1f C A 5: 120,855,429 Q235K probably damaging Het
Olfr109 T A 17: 37,467,047 S280R probably damaging Het
Olfr59 G T 11: 74,289,213 C189F probably damaging Het
Olfr60 T A 7: 140,345,987 M1L probably benign Het
Olfr629 T C 7: 103,741,174 N22S probably benign Het
Olfr857 C T 9: 19,713,090 H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pde1b A G 15: 103,525,340 probably null Het
Pdilt T C 7: 119,489,384 T465A probably benign Het
Plxnd1 T C 6: 115,966,546 H1233R probably damaging Het
Ppm1b T A 17: 84,994,124 M144K probably benign Het
Prkdc T C 16: 15,808,058 L3316S probably benign Het
Prm2 T A 16: 10,791,591 probably benign Het
Prmt7 T C 8: 106,237,008 V240A probably benign Het
Prx C A 7: 27,518,888 A938E possibly damaging Het
Rbm7 A G 9: 48,490,894 V131A probably benign Het
Ric1 T A 19: 29,600,813 probably null Het
Rnf150 A T 8: 82,864,010 M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 R298W probably damaging Het
Rp1 T A 1: 4,347,232 Y1219F possibly damaging Het
Scn7a A G 2: 66,684,013 probably null Het
Sdad1 A G 5: 92,292,651 probably null Het
Sept9 T C 11: 117,353,083 probably benign Het
Serinc3 T C 2: 163,645,489 probably benign Het
Shc3 C T 13: 51,461,388 G178R probably damaging Het
Slc4a10 A T 2: 62,316,606 K1090M probably damaging Het
Slco1a1 T C 6: 141,923,111 I376V probably benign Het
Slmap A T 14: 26,422,574 F719L probably benign Het
Smgc A G 15: 91,859,758 N573D possibly damaging Het
Spx G A 6: 142,414,079 probably null Het
Srrt C G 5: 137,296,945 E308Q probably damaging Het
Tas2r130 T A 6: 131,630,597 R78S probably benign Het
Tchhl1 A G 3: 93,471,101 R371G probably damaging Het
Teddm2 C T 1: 153,850,448 A174T probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Trim33 T C 3: 103,324,640 probably benign Het
Tspan31 A G 10: 127,069,458 V40A probably damaging Het
Uevld A G 7: 46,945,227 probably benign Het
Vcl G T 14: 21,008,995 A560S probably benign Het
Vmn2r24 T A 6: 123,816,224 C837S probably damaging Het
Vmn2r57 C T 7: 41,428,107 V212M probably damaging Het
Vps13c A G 9: 67,936,340 T1968A probably benign Het
Vtn A G 11: 78,500,567 R269G probably damaging Het
Wdcp G A 12: 4,850,245 V34I possibly damaging Het
Zc3h14 A G 12: 98,752,832 D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 P123L probably benign Het
Zfp318 T C 17: 46,406,055 S1038P possibly damaging Het
Zfp873 A G 10: 82,060,572 D416G probably benign Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATGACCTATGAGCATTTGGC -3'
(R):5'- CATCTTCTTCAAGACGCCAAG -3'

Sequencing Primer
(F):5'- ATGAGCATTTGGCCCTAGAC -3'
(R):5'- TCTTCTTCAAGACGCCAAGGGAAG -3'
Posted On2014-06-23