Incidental Mutation 'R0116:Atp2b2'
ID20794
Institutional Source Beutler Lab
Gene Symbol Atp2b2
Ensembl Gene ENSMUSG00000030302
Gene NameATPase, Ca++ transporting, plasma membrane 2
SynonymsPMCA2, D6Abb2e, wms, jog, Gena300, Tmy
MMRRC Submission 038402-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R0116 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location113743831-114042613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113793695 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 418 (V418I)
Ref Sequence ENSEMBL: ENSMUSP00000145174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089003] [ENSMUST00000101044] [ENSMUST00000101045] [ENSMUST00000152831] [ENSMUST00000205052]
Predicted Effect probably damaging
Transcript: ENSMUST00000089003
AA Change: V418I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086398
Gene: ENSMUSG00000030302
AA Change: V418I

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101044
AA Change: V463I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098605
Gene: ENSMUSG00000030302
AA Change: V463I

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 307 4.2e-28 PFAM
low complexity region 313 330 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
Pfam:E1-E2_ATPase 373 488 1.4e-13 PFAM
Pfam:Hydrolase 493 832 8.1e-16 PFAM
Pfam:HAD 496 829 6.3e-21 PFAM
Pfam:Cation_ATPase 542 638 4.4e-17 PFAM
Pfam:Hydrolase_3 791 865 8.3e-7 PFAM
transmembrane domain 878 900 N/A INTRINSIC
Pfam:Cation_ATPase_C 902 1084 2.5e-47 PFAM
low complexity region 1102 1115 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1126 1178 2.4e-30 PFAM
low complexity region 1196 1211 N/A INTRINSIC
low complexity region 1220 1234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101045
AA Change: V418I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098606
Gene: ENSMUSG00000030302
AA Change: V418I

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152831
AA Change: V418I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138165
Gene: ENSMUSG00000030302
AA Change: V418I

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 6.1e-57 PFAM
Pfam:Hydrolase 448 787 1.4e-25 PFAM
Pfam:HAD 451 784 7.7e-17 PFAM
Pfam:Hydrolase_like2 497 593 4.4e-17 PFAM
Pfam:Hydrolase_3 745 820 4.2e-7 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 2.7e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1149 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204957
Predicted Effect probably damaging
Transcript: ENSMUST00000205052
AA Change: V418I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145174
Gene: ENSMUSG00000030302
AA Change: V418I

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 310 1.9e-28 PFAM
Pfam:E1-E2_ATPase 328 443 1.1e-13 PFAM
Pfam:HAD 451 780 2.7e-19 PFAM
Pfam:Cation_ATPase 497 593 5.8e-17 PFAM
Pfam:Hydrolase 576 783 2e-8 PFAM
Pfam:Hydrolase_3 711 816 2.3e-7 PFAM
transmembrane domain 829 851 N/A INTRINSIC
Pfam:Cation_ATPase_C 853 1035 2.5e-47 PFAM
low complexity region 1053 1066 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1077 1129 2.6e-30 PFAM
low complexity region 1147 1162 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 94% (95/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit slower growth, balance problems, and deafness, associated with cerebellar abnormalities, an absence of otoconia, and abnormalities of the organ of Corti. Heterozygotes exhibit appreciable age-dependent hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,290,770 V152E probably damaging Het
Abca5 T G 11: 110,276,505 E1495A probably damaging Het
Abcc12 G A 8: 86,534,998 S668F probably benign Het
Adgrl4 A T 3: 151,517,610 T608S probably benign Het
Angel2 G A 1: 190,940,990 D255N probably benign Het
Apob T A 12: 7,989,113 probably benign Het
Arfgef2 A T 2: 166,873,683 R1349S probably damaging Het
Birc6 C A 17: 74,623,746 probably benign Het
Capn13 T A 17: 73,351,524 Y183F probably damaging Het
Cngb1 A G 8: 95,260,638 S352P probably damaging Het
Col6a3 A G 1: 90,813,551 S720P probably damaging Het
Cpa4 C T 6: 30,579,658 R155W probably damaging Het
Dapk1 A G 13: 60,761,100 I1176V probably benign Het
Dnah17 T C 11: 118,058,306 E2959G probably benign Het
Dnah7b T A 1: 46,213,360 I1734N possibly damaging Het
Dnajb7 A G 15: 81,407,354 Y261H probably benign Het
Dock2 T C 11: 34,688,565 probably benign Het
Dusp27 A C 1: 166,099,701 S781A probably benign Het
Dyrk3 A T 1: 131,129,839 V199E probably damaging Het
F2r G T 13: 95,604,486 C180* probably null Het
F5 A G 1: 164,184,914 S466G probably benign Het
Fbn2 A T 18: 58,102,373 C677* probably null Het
Fbxo41 A G 6: 85,477,908 S673P probably damaging Het
Fhad1 G T 4: 141,940,095 H639N probably benign Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Foxa2 A G 2: 148,043,561 S270P probably damaging Het
Fxyd7 C T 7: 31,047,368 probably null Het
Gm5225 A G 17: 24,024,058 D67G probably benign Het
Grik3 G A 4: 125,670,556 E444K probably benign Het
Gsdma2 A G 11: 98,649,183 K44E probably damaging Het
Haus1 T A 18: 77,762,070 K130* probably null Het
Heg1 A G 16: 33,735,658 probably benign Het
Hormad2 A G 11: 4,412,206 probably benign Het
Hsd17b3 G A 13: 64,058,589 R300C possibly damaging Het
Irf5 T C 6: 29,536,109 F374S probably damaging Het
Itch A G 2: 155,217,983 probably benign Het
Jade2 A T 11: 51,831,309 L139Q probably damaging Het
Kif5c G A 2: 49,752,239 probably benign Het
Lama1 T C 17: 67,776,923 Y1387H probably benign Het
Larp4b A G 13: 9,170,688 R658G probably damaging Het
Mcph1 C T 8: 18,788,248 L729F probably benign Het
Me1 A T 9: 86,654,667 N118K probably benign Het
Med13 A G 11: 86,319,897 L473S probably damaging Het
Mgam T A 6: 40,658,987 Y359N probably damaging Het
Morc2b A G 17: 33,137,041 S586P probably damaging Het
Mthfr A G 4: 148,051,523 D310G probably benign Het
Mtmr7 A T 8: 40,581,405 probably benign Het
Mtus1 A G 8: 40,998,477 probably benign Het
Mus81 G T 19: 5,486,524 A138D probably damaging Het
Myom2 A T 8: 15,117,633 I1073F probably damaging Het
Nhsl1 A T 10: 18,525,242 K739* probably null Het
Nlrp4d T A 7: 10,374,891 K762N probably benign Het
Nrap T C 19: 56,355,546 Y724C probably damaging Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr805 T A 10: 129,722,977 D189V probably damaging Het
Olfr923 T C 9: 38,828,564 L291P probably damaging Het
Olfr948 A T 9: 39,318,864 I250N probably damaging Het
Padi2 T C 4: 140,926,239 V180A probably benign Het
Papss2 C T 19: 32,638,368 R167* probably null Het
Pcbp2 T C 15: 102,474,235 probably benign Het
Per1 T A 11: 69,101,880 probably benign Het
Pik3ca T C 3: 32,459,945 I860T probably damaging Het
Pkdrej G A 15: 85,817,545 Q1397* probably null Het
Plce1 T C 19: 38,721,821 V1133A probably benign Het
Pnmal1 T G 7: 16,960,700 V160G probably damaging Het
Prss12 T C 3: 123,482,774 C351R probably damaging Het
Qprt A T 7: 127,109,097 L54Q probably damaging Het
Raf1 C T 6: 115,626,383 S165N probably damaging Het
Rere A G 4: 150,616,976 N1271S probably benign Het
Rnasel T A 1: 153,754,512 L258H probably damaging Het
Ryr2 T C 13: 11,709,921 D2502G probably damaging Het
Ryr3 G A 2: 112,803,165 S2081L probably damaging Het
Sc5d G T 9: 42,259,859 Y11* probably null Het
Slc25a29 A C 12: 108,827,091 L187R possibly damaging Het
Slc2a7 G A 4: 150,168,264 V454M probably benign Het
Slco1b2 A T 6: 141,669,388 T340S probably benign Het
Smarcc1 A G 9: 110,147,104 N153S possibly damaging Het
Snx1 C A 9: 66,088,539 E516* probably null Het
Sptlc2 T C 12: 87,356,680 D115G probably benign Het
Stard9 A G 2: 120,634,255 N67S probably damaging Het
Swap70 G A 7: 110,273,282 R368H probably benign Het
Tcaf3 T C 6: 42,591,350 K691E probably benign Het
Tmco4 T C 4: 139,053,920 F465S probably damaging Het
Tmem245 A G 4: 56,926,213 S290P probably benign Het
Top2a T C 11: 99,003,590 T972A probably benign Het
Tpr T A 1: 150,410,147 S527R probably damaging Het
Traf2 T C 2: 25,519,609 D443G probably damaging Het
Trim40 A T 17: 36,883,147 probably null Het
Trim42 A T 9: 97,363,403 I448N possibly damaging Het
Ttll9 G A 2: 152,983,134 V78M probably damaging Het
Vav1 C T 17: 57,296,039 L88F probably damaging Het
Vps13b A G 15: 35,423,155 D207G probably damaging Het
Wdsub1 A G 2: 59,876,665 probably null Het
Zfp799 A G 17: 32,821,035 W85R possibly damaging Het
Zfp839 A T 12: 110,858,769 probably benign Het
Other mutations in Atp2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Atp2b2 APN 6 113805515 missense possibly damaging 0.69
IGL01140:Atp2b2 APN 6 113789971 missense possibly damaging 0.94
IGL02065:Atp2b2 APN 6 113813867 missense probably damaging 1.00
IGL02267:Atp2b2 APN 6 113793730 missense probably damaging 1.00
IGL02383:Atp2b2 APN 6 113813942 missense probably damaging 0.99
IGL02498:Atp2b2 APN 6 113793854 missense probably damaging 0.99
IGL02631:Atp2b2 APN 6 113748545 missense probably damaging 1.00
IGL03028:Atp2b2 APN 6 113759142 missense probably damaging 0.99
IGL03221:Atp2b2 APN 6 113760859 splice site probably benign
IGL03290:Atp2b2 APN 6 113793754 missense probably damaging 1.00
johan UTSW 6 113773388 missense probably damaging 1.00
lohan UTSW 6 113760650 missense probably damaging 1.00
IGL02799:Atp2b2 UTSW 6 113762852 nonsense probably null
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0132:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0195:Atp2b2 UTSW 6 113793874 missense probably benign 0.07
R0421:Atp2b2 UTSW 6 113813888 missense probably damaging 1.00
R0791:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R0792:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R1033:Atp2b2 UTSW 6 113793888 splice site probably null
R1248:Atp2b2 UTSW 6 113817192 missense probably damaging 1.00
R1524:Atp2b2 UTSW 6 113774201 splice site probably benign
R1809:Atp2b2 UTSW 6 113803743 intron probably benign
R1829:Atp2b2 UTSW 6 113773368 missense probably damaging 1.00
R1854:Atp2b2 UTSW 6 113842283 missense probably damaging 1.00
R2127:Atp2b2 UTSW 6 113760650 missense probably damaging 1.00
R2138:Atp2b2 UTSW 6 113796307 missense probably benign 0.21
R2351:Atp2b2 UTSW 6 113789757 missense possibly damaging 0.91
R3923:Atp2b2 UTSW 6 113797108 critical splice donor site probably null
R3951:Atp2b2 UTSW 6 113760831 missense possibly damaging 0.51
R4178:Atp2b2 UTSW 6 113793718 missense probably damaging 1.00
R4353:Atp2b2 UTSW 6 113765784 missense probably benign 0.01
R4578:Atp2b2 UTSW 6 113760711 missense probably damaging 1.00
R4797:Atp2b2 UTSW 6 113789886 missense possibly damaging 0.92
R4884:Atp2b2 UTSW 6 113842186 missense possibly damaging 0.65
R4976:Atp2b2 UTSW 6 113759161 missense probably damaging 1.00
R5273:Atp2b2 UTSW 6 113759232 missense probably damaging 1.00
R5350:Atp2b2 UTSW 6 113759238 missense probably damaging 0.99
R5414:Atp2b2 UTSW 6 113842141 missense probably damaging 1.00
R5560:Atp2b2 UTSW 6 113774358 missense possibly damaging 0.90
R5589:Atp2b2 UTSW 6 113774439 missense possibly damaging 0.94
R5790:Atp2b2 UTSW 6 113759309 missense probably damaging 0.97
R6001:Atp2b2 UTSW 6 113793767 missense probably damaging 1.00
R6127:Atp2b2 UTSW 6 113813877 missense probably damaging 1.00
R6331:Atp2b2 UTSW 6 113797131 missense probably benign 0.01
R6925:Atp2b2 UTSW 6 113760720 missense probably damaging 1.00
R7231:Atp2b2 UTSW 6 113765732 missense possibly damaging 0.89
X0020:Atp2b2 UTSW 6 113805499 missense probably damaging 1.00
X0020:Atp2b2 UTSW 6 113805500 missense probably damaging 1.00
Z1088:Atp2b2 UTSW 6 113842306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCACACATTTCGTAGCCCATC -3'
(R):5'- ACTGAGGCTCCCTGAGAAGCAAAG -3'

Sequencing Primer
(F):5'- CATTTCGTAGCCCATCTACAAAG -3'
(R):5'- ctgagaagcaaagcaaaggac -3'
Posted On2013-04-11