Incidental Mutation 'R1850:Pbx3'
ID207978
Institutional Source Beutler Lab
Gene Symbol Pbx3
Ensembl Gene ENSMUSG00000038718
Gene Namepre B cell leukemia homeobox 3
Synonyms
MMRRC Submission 039874-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1850 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34171457-34373142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34176820 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 351 (F351I)
Ref Sequence ENSEMBL: ENSMUSP00000045281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040638] [ENSMUST00000113132] [ENSMUST00000143776] [ENSMUST00000153278]
Predicted Effect probably benign
Transcript: ENSMUST00000040638
AA Change: F351I

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045281
Gene: ENSMUSG00000038718
AA Change: F351I

DomainStartEndE-ValueType
Pfam:PBC 43 234 2.7e-97 PFAM
HOX 235 300 1.74e-17 SMART
low complexity region 308 341 N/A INTRINSIC
Blast:HOX 342 385 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113132
SMART Domains Protein: ENSMUSP00000108757
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 234 8.5e-103 PFAM
HOX 235 300 8.8e-20 SMART
low complexity region 308 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143776
SMART Domains Protein: ENSMUSP00000119914
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153278
SMART Domains Protein: ENSMUSP00000123567
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175855
SMART Domains Protein: ENSMUSP00000135838
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 1 53 1.6e-27 PFAM
HOX 54 119 8.8e-20 SMART
low complexity region 127 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176213
SMART Domains Protein: ENSMUSP00000135702
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 2 145 3.2e-76 PFAM
HOX 146 211 1.74e-17 SMART
low complexity region 219 247 N/A INTRINSIC
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality with hypoventilation and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik T C 19: 28,939,171 probably null Het
6030419C18Rik A T 9: 58,499,109 M101L probably benign Het
Adam28 T A 14: 68,639,195 Q202L probably benign Het
Adgb C A 10: 10,442,502 V199F probably damaging Het
Aff1 G T 5: 103,833,907 R645S probably damaging Het
Aoc1 C T 6: 48,905,268 S48F probably benign Het
Atf6 A T 1: 170,819,286 N339K probably damaging Het
Bpifb3 C G 2: 153,929,344 S392C possibly damaging Het
Camk1d T C 2: 5,362,015 M130V probably benign Het
Ces1a T A 8: 93,027,326 N350Y probably damaging Het
Cfap57 G A 4: 118,599,894 R453C probably damaging Het
Chd4 T A 6: 125,121,656 N1532K probably damaging Het
Chd5 T C 4: 152,370,533 L824P probably damaging Het
Ckap5 G A 2: 91,595,713 R1306H probably damaging Het
Crybg1 A G 10: 43,997,674 F1146S probably damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Dync2h1 T C 9: 7,001,448 T3854A probably benign Het
Echdc1 A T 10: 29,344,603 I252F probably damaging Het
Emc1 A T 4: 139,359,373 probably benign Het
Fbn2 C A 18: 58,039,305 probably benign Het
Fsip2 T A 2: 82,984,589 N3555K possibly damaging Het
Gabra1 T A 11: 42,179,576 T20S probably benign Het
H2afy T C 13: 56,096,239 probably benign Het
Igf1 A C 10: 87,861,374 T2P possibly damaging Het
Jcad C A 18: 4,675,730 T1164N possibly damaging Het
Kalrn A T 16: 33,975,923 S2830T probably damaging Het
Lepr C A 4: 101,733,423 A66E possibly damaging Het
Lmntd1 T A 6: 145,413,480 M315L probably benign Het
Lrch3 A G 16: 32,986,793 T479A probably benign Het
Matr3 A G 18: 35,582,057 N237D probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtif2 A G 11: 29,540,683 I462M probably benign Het
Nrip1 T C 16: 76,293,344 I442V probably damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr1415 T A 1: 92,491,402 M118L possibly damaging Het
Olfr741 G A 14: 50,485,598 A47T probably benign Het
Otogl T A 10: 107,878,064 Y498F probably damaging Het
Pcdh18 T C 3: 49,756,405 T154A probably benign Het
Pex5l A T 3: 32,950,876 probably null Het
Plec T C 15: 76,188,232 I718V probably benign Het
Pparg T A 6: 115,450,980 Y143N probably damaging Het
Prl2c5 A G 13: 13,185,792 I12V probably benign Het
Rcor3 T A 1: 192,120,111 Q246L probably benign Het
Rnf214 A T 9: 45,869,448 probably benign Het
S1pr5 A T 9: 21,244,129 S334T probably benign Het
Scg3 C T 9: 75,682,167 S35N possibly damaging Het
Sept5 A T 16: 18,625,210 L19Q probably damaging Het
Serpinb7 T C 1: 107,428,295 F16S probably damaging Het
Sipa1l3 A T 7: 29,339,126 S365R probably damaging Het
Slc27a1 T C 8: 71,580,703 probably null Het
Slc2a10 C A 2: 165,515,213 H264Q probably benign Het
Slc9a3 A G 13: 74,161,770 I526V probably benign Het
Smchd1 T C 17: 71,389,771 D1203G probably damaging Het
Sult1b1 A G 5: 87,520,841 W181R probably damaging Het
Supt6 A G 11: 78,219,877 probably benign Het
Tcf12 C A 9: 71,868,215 A418S probably damaging Het
Tesk1 C T 4: 43,443,576 R48C probably damaging Het
Tiam2 A G 17: 3,437,235 Q677R probably damaging Het
Tspan8 C T 10: 115,833,225 A55V probably damaging Het
Txndc11 T C 16: 11,088,404 N421D probably damaging Het
Vmn1r201 A G 13: 22,474,631 N5S probably benign Het
Vmn2r120 T A 17: 57,525,826 I118L probably benign Het
Vps13b A T 15: 35,674,959 probably benign Het
Wdfy3 A G 5: 101,894,999 V1962A probably damaging Het
Zswim8 C T 14: 20,710,747 R107* probably null Het
Other mutations in Pbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02468:Pbx3 APN 2 34224577 missense probably damaging 1.00
IGL02524:Pbx3 APN 2 34370818 splice site probably benign
PIT4812001:Pbx3 UTSW 2 34224619 missense probably damaging 0.96
R0302:Pbx3 UTSW 2 34224560 missense probably benign 0.42
R1526:Pbx3 UTSW 2 34371764 missense probably damaging 1.00
R1529:Pbx3 UTSW 2 34204859 missense probably damaging 1.00
R1627:Pbx3 UTSW 2 34175953 missense probably benign 0.00
R1652:Pbx3 UTSW 2 34224556 missense probably damaging 1.00
R1791:Pbx3 UTSW 2 34224452 missense possibly damaging 0.95
R2908:Pbx3 UTSW 2 34172921 missense probably damaging 0.96
R4073:Pbx3 UTSW 2 34224412 missense probably damaging 1.00
R5212:Pbx3 UTSW 2 34288781 intron probably benign
R5897:Pbx3 UTSW 2 34371908 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAAATGTGTCCCGTTTGG -3'
(R):5'- TAAGTAGCAGGACCTTCCAGAG -3'

Sequencing Primer
(F):5'- CCAGCACAGGTTCTGCATAGATG -3'
(R):5'- AGGACCTTCCAGAGCTCCTTTAATG -3'
Posted On2014-06-23