Incidental Mutation 'R1850:Mslnl'
ID208036
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
MMRRC Submission 039874-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R1850 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25742934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik T C 19: 28,939,171 probably null Het
6030419C18Rik A T 9: 58,499,109 M101L probably benign Het
Adam28 T A 14: 68,639,195 Q202L probably benign Het
Adgb C A 10: 10,442,502 V199F probably damaging Het
Aff1 G T 5: 103,833,907 R645S probably damaging Het
Aoc1 C T 6: 48,905,268 S48F probably benign Het
Atf6 A T 1: 170,819,286 N339K probably damaging Het
Bpifb3 C G 2: 153,929,344 S392C possibly damaging Het
Camk1d T C 2: 5,362,015 M130V probably benign Het
Ces1a T A 8: 93,027,326 N350Y probably damaging Het
Cfap57 G A 4: 118,599,894 R453C probably damaging Het
Chd4 T A 6: 125,121,656 N1532K probably damaging Het
Chd5 T C 4: 152,370,533 L824P probably damaging Het
Ckap5 G A 2: 91,595,713 R1306H probably damaging Het
Crybg1 A G 10: 43,997,674 F1146S probably damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Dync2h1 T C 9: 7,001,448 T3854A probably benign Het
Echdc1 A T 10: 29,344,603 I252F probably damaging Het
Emc1 A T 4: 139,359,373 probably benign Het
Fbn2 C A 18: 58,039,305 probably benign Het
Fsip2 T A 2: 82,984,589 N3555K possibly damaging Het
Gabra1 T A 11: 42,179,576 T20S probably benign Het
H2afy T C 13: 56,096,239 probably benign Het
Igf1 A C 10: 87,861,374 T2P possibly damaging Het
Jcad C A 18: 4,675,730 T1164N possibly damaging Het
Kalrn A T 16: 33,975,923 S2830T probably damaging Het
Lepr C A 4: 101,733,423 A66E possibly damaging Het
Lmntd1 T A 6: 145,413,480 M315L probably benign Het
Lrch3 A G 16: 32,986,793 T479A probably benign Het
Matr3 A G 18: 35,582,057 N237D probably damaging Het
Mtif2 A G 11: 29,540,683 I462M probably benign Het
Nrip1 T C 16: 76,293,344 I442V probably damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr1415 T A 1: 92,491,402 M118L possibly damaging Het
Olfr741 G A 14: 50,485,598 A47T probably benign Het
Otogl T A 10: 107,878,064 Y498F probably damaging Het
Pbx3 A T 2: 34,176,820 F351I probably benign Het
Pcdh18 T C 3: 49,756,405 T154A probably benign Het
Pex5l A T 3: 32,950,876 probably null Het
Plec T C 15: 76,188,232 I718V probably benign Het
Pparg T A 6: 115,450,980 Y143N probably damaging Het
Prl2c5 A G 13: 13,185,792 I12V probably benign Het
Rcor3 T A 1: 192,120,111 Q246L probably benign Het
Rnf214 A T 9: 45,869,448 probably benign Het
S1pr5 A T 9: 21,244,129 S334T probably benign Het
Scg3 C T 9: 75,682,167 S35N possibly damaging Het
Sept5 A T 16: 18,625,210 L19Q probably damaging Het
Serpinb7 T C 1: 107,428,295 F16S probably damaging Het
Sipa1l3 A T 7: 29,339,126 S365R probably damaging Het
Slc27a1 T C 8: 71,580,703 probably null Het
Slc2a10 C A 2: 165,515,213 H264Q probably benign Het
Slc9a3 A G 13: 74,161,770 I526V probably benign Het
Smchd1 T C 17: 71,389,771 D1203G probably damaging Het
Sult1b1 A G 5: 87,520,841 W181R probably damaging Het
Supt6 A G 11: 78,219,877 probably benign Het
Tcf12 C A 9: 71,868,215 A418S probably damaging Het
Tesk1 C T 4: 43,443,576 R48C probably damaging Het
Tiam2 A G 17: 3,437,235 Q677R probably damaging Het
Tspan8 C T 10: 115,833,225 A55V probably damaging Het
Txndc11 T C 16: 11,088,404 N421D probably damaging Het
Vmn1r201 A G 13: 22,474,631 N5S probably benign Het
Vmn2r120 T A 17: 57,525,826 I118L probably benign Het
Vps13b A T 15: 35,674,959 probably benign Het
Wdfy3 A G 5: 101,894,999 V1962A probably damaging Het
Zswim8 C T 14: 20,710,747 R107* probably null Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGCCATCAGAAGGGAGGTTTG -3'
(R):5'- ACAGGTCTGAAGCACTGAGC -3'

Sequencing Primer
(F):5'- TTTGAACCCAGGACTGAGGTGAC -3'
(R):5'- GCCCTGCCGAGACAGTAG -3'
Posted On2014-06-23