Incidental Mutation 'R1851:Dhx29'
ID208132
Institutional Source Beutler Lab
Gene Symbol Dhx29
Ensembl Gene ENSMUSG00000042426
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 29
SynonymsE130202M19Rik
MMRRC Submission 039875-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1851 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112927454-112969432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112948281 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 678 (T678A)
Ref Sequence ENSEMBL: ENSMUSP00000035244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038574]
Predicted Effect probably damaging
Transcript: ENSMUST00000038574
AA Change: T678A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: T678A

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik A G 12: 18,533,686 E225G possibly damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Abi1 A T 2: 22,950,264 V329D possibly damaging Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acox3 A T 5: 35,609,062 D624V possibly damaging Het
Adam6b A G 12: 113,491,822 D753G probably benign Het
Ago1 C A 4: 126,439,995 R771L probably benign Het
Aktip A G 8: 91,125,877 V217A possibly damaging Het
Ankk1 A C 9: 49,415,850 H676Q probably benign Het
Arl1 G C 10: 88,733,546 probably benign Het
Asxl3 T A 18: 22,517,739 D928E probably damaging Het
AW209491 T C 13: 14,636,733 V57A possibly damaging Het
B3galt4 G T 17: 33,950,911 Q118K probably benign Het
Ccdc187 A T 2: 26,276,068 M783K probably benign Het
Cdon T G 9: 35,483,158 M900R probably damaging Het
Ceacam5 G A 7: 17,714,910 W67* probably null Het
Chd5 A G 4: 152,378,270 S1356G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cpz C A 5: 35,502,558 R581L possibly damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cym T A 3: 107,218,714 I78F probably benign Het
Defb8 A T 8: 19,445,883 S54T probably benign Het
Dennd4a A G 9: 64,862,030 T433A probably damaging Het
Dspp T C 5: 104,174,085 probably null Het
Enkur G T 2: 21,189,177 A195E probably benign Het
Ero1lb T A 13: 12,604,403 S429T possibly damaging Het
Fh1 A G 1: 175,607,886 S344P probably damaging Het
Flnc G T 6: 29,443,479 G553V probably damaging Het
Fmo1 A T 1: 162,829,985 L529* probably null Het
Frem1 C A 4: 82,950,500 V1415F probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gdpgp1 A T 7: 80,238,601 N127Y probably damaging Het
Gm11492 T A 11: 87,568,915 D496E probably damaging Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gm13212 T G 4: 145,624,250 probably benign Het
Gpat2 A G 2: 127,434,819 T648A possibly damaging Het
Grk6 C T 13: 55,451,778 R225* probably null Het
Hells A T 19: 38,959,676 Q682L probably null Het
Hspa5 T A 2: 34,774,678 N381K possibly damaging Het
Ighmbp2 T C 19: 3,262,075 N893S probably benign Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lats2 A G 14: 57,697,455 L606P probably damaging Het
Map4k1 T C 7: 28,999,784 Y521H probably benign Het
March11 T A 15: 26,387,830 V257E probably damaging Het
Med23 G A 10: 24,910,870 probably null Het
Meltf A G 16: 31,896,577 D696G probably benign Het
Ms4a7 T A 19: 11,324,424 M212L probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myh1 T C 11: 67,204,398 Y195H probably damaging Het
Napb G T 2: 148,706,989 H110Q probably benign Het
Ngly1 C T 14: 16,260,585 P90S probably damaging Het
Nlrp1b T A 11: 71,182,616 I134L possibly damaging Het
Nup210 A G 6: 91,016,054 L1017P probably damaging Het
Nup85 T A 11: 115,581,817 I233N probably damaging Het
Obsl1 A G 1: 75,492,893 V965A probably damaging Het
Olfr1259 A C 2: 89,943,814 Y100* probably null Het
Olfr1310 T C 2: 112,008,691 D165G probably benign Het
Olfr787 T C 10: 129,463,501 L275P probably damaging Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Pard6g C T 18: 80,117,142 R157C probably damaging Het
Pcdhb7 A T 18: 37,342,578 T256S possibly damaging Het
Phrf1 T C 7: 141,240,918 F153L probably damaging Het
Pigw A T 11: 84,878,048 F152I probably damaging Het
Pip4k2c A G 10: 127,200,875 S222P probably damaging Het
Pjvk A G 2: 76,657,431 probably null Het
Plxnd1 C T 6: 115,963,914 V1355M probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Scn7a T C 2: 66,680,291 I1256V probably benign Het
Sema4d A G 13: 51,711,222 V362A possibly damaging Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Tacc3 G T 5: 33,668,200 V425L probably benign Het
Tfdp2 A T 9: 96,297,709 K125I probably damaging Het
Tjp2 C T 19: 24,099,535 R952Q possibly damaging Het
Tk2 G T 8: 104,248,445 S30* probably null Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Tmprss9 G A 10: 80,892,285 V570M probably damaging Het
Tnk2 C A 16: 32,679,462 P26Q probably damaging Het
Tnpo2 T G 8: 85,051,772 V610G probably damaging Het
Trim37 T C 11: 87,218,306 F953S probably damaging Het
U2surp T A 9: 95,482,097 K589* probably null Het
Usp2 G A 9: 44,075,966 R187H probably benign Het
Vmn2r1 C T 3: 64,101,505 T535I probably benign Het
Wdr20rt T A 12: 65,227,151 S463T possibly damaging Het
Zbtb25 C A 12: 76,349,714 G245W probably damaging Het
Zc3h14 T A 12: 98,760,354 L27* probably null Het
Zfp2 T C 11: 50,901,088 K43E probably benign Het
Zfp654 A G 16: 64,785,128 Y904H probably benign Het
Other mutations in Dhx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Dhx29 APN 13 112964603 missense probably benign 0.15
IGL00434:Dhx29 APN 13 112955225 missense probably benign 0.00
IGL00659:Dhx29 APN 13 112966635 splice site probably benign
IGL01618:Dhx29 APN 13 112965222 missense probably damaging 1.00
IGL01777:Dhx29 APN 13 112930872 missense probably benign 0.42
IGL02010:Dhx29 APN 13 112966634 critical splice donor site probably null
IGL02125:Dhx29 APN 13 112955300 splice site probably benign
IGL02324:Dhx29 APN 13 112927808 missense probably damaging 1.00
IGL02801:Dhx29 APN 13 112964646 missense probably damaging 1.00
R0001:Dhx29 UTSW 13 112964556 missense probably damaging 0.99
R0362:Dhx29 UTSW 13 112962859 missense probably benign
R0468:Dhx29 UTSW 13 112963277 missense probably benign
R0569:Dhx29 UTSW 13 112948214 missense probably benign 0.01
R0714:Dhx29 UTSW 13 112927965 missense possibly damaging 0.55
R1460:Dhx29 UTSW 13 112965210 splice site probably benign
R1579:Dhx29 UTSW 13 112935598 critical splice donor site probably null
R1657:Dhx29 UTSW 13 112952843 missense probably damaging 1.00
R1735:Dhx29 UTSW 13 112945086 missense probably benign 0.00
R1768:Dhx29 UTSW 13 112948240 missense probably damaging 1.00
R1937:Dhx29 UTSW 13 112965330 missense probably benign 0.06
R2180:Dhx29 UTSW 13 112962872 critical splice donor site probably null
R2219:Dhx29 UTSW 13 112952804 missense probably damaging 1.00
R2442:Dhx29 UTSW 13 112946974 missense possibly damaging 0.94
R2679:Dhx29 UTSW 13 112947376 critical splice donor site probably null
R2908:Dhx29 UTSW 13 112927851 missense possibly damaging 0.78
R2912:Dhx29 UTSW 13 112935575 missense probably damaging 1.00
R3414:Dhx29 UTSW 13 112947273 missense probably damaging 0.99
R3931:Dhx29 UTSW 13 112958965 missense probably damaging 1.00
R3957:Dhx29 UTSW 13 112930921 missense probably benign
R4065:Dhx29 UTSW 13 112964742 critical splice donor site probably null
R4207:Dhx29 UTSW 13 112927949 missense probably benign 0.01
R4422:Dhx29 UTSW 13 112947247 missense probably damaging 1.00
R4717:Dhx29 UTSW 13 112946935 missense unknown
R4718:Dhx29 UTSW 13 112946935 missense unknown
R5125:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5178:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5263:Dhx29 UTSW 13 112948221 missense probably damaging 1.00
R5458:Dhx29 UTSW 13 112966621 missense probably benign 0.00
R5469:Dhx29 UTSW 13 112944539 missense possibly damaging 0.94
R5541:Dhx29 UTSW 13 112940374 missense possibly damaging 0.47
R5573:Dhx29 UTSW 13 112933215 missense probably benign 0.07
R5664:Dhx29 UTSW 13 112946879 missense probably damaging 1.00
R5682:Dhx29 UTSW 13 112930849 missense probably damaging 1.00
R5769:Dhx29 UTSW 13 112953717 missense probably damaging 0.99
R5917:Dhx29 UTSW 13 112962843 missense probably damaging 1.00
R5928:Dhx29 UTSW 13 112964468 missense probably benign 0.00
R6115:Dhx29 UTSW 13 112952801 critical splice acceptor site probably null
R6144:Dhx29 UTSW 13 112964571 missense probably damaging 1.00
R6195:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6233:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6430:Dhx29 UTSW 13 112944619 missense possibly damaging 0.77
R6480:Dhx29 UTSW 13 112953788 nonsense probably null
R6527:Dhx29 UTSW 13 112932542 missense probably damaging 1.00
R6856:Dhx29 UTSW 13 112952861 missense probably benign 0.43
R7391:Dhx29 UTSW 13 112962859 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGCCCAAGCCTACACTTG -3'
(R):5'- GGAAGGCATATGATATGTACCTGC -3'

Sequencing Primer
(F):5'- CAGCTTGGGATCCACTGTGTAAC -3'
(R):5'- GGCATATGATATGTACCTGCATAGG -3'
Posted On2014-06-23