Incidental Mutation 'R1852:Dnah17'
ID208241
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Namedynein, axonemal, heavy chain 17
SynonymsLOC382552, Dnahcl1, 2810003K23Rik, Dnahc17
MMRRC Submission 039876-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1852 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118021723-118130634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118121916 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 145 (I145F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]
Predicted Effect probably damaging
Transcript: ENSMUST00000084803
AA Change: I440F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: I440F

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106308
AA Change: I440F

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: I440F

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124164
AA Change: I145F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115370
Gene: ENSMUSG00000033987
AA Change: I145F

DomainStartEndE-ValueType
Pfam:DHC_N1 1 471 2e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132685
AA Change: I440F

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: I440F

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134069
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,268,473 D499G probably damaging Het
2900092C05Rik A G 7: 12,512,702 probably null Het
4930433I11Rik T A 7: 40,993,613 D326E probably benign Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Abca8a T C 11: 110,069,386 D676G probably damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acsl6 T C 11: 54,361,076 I683T probably damaging Het
Adgrg5 A T 8: 94,937,800 Y345F probably damaging Het
Alg6 T G 4: 99,746,362 F114V probably benign Het
Ank2 A C 3: 126,997,851 probably null Het
Ankrd24 A T 10: 81,642,941 probably benign Het
Ano8 T C 8: 71,483,487 K222E probably damaging Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Bmpr1b A T 3: 141,857,402 probably null Het
C3 A G 17: 57,222,823 V2A probably damaging Het
Capn1 A G 19: 6,009,103 V276A possibly damaging Het
Ccdc57 T C 11: 120,921,673 E85G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chl1 A T 6: 103,699,159 probably null Het
Chodl C T 16: 78,941,258 P38L probably benign Het
Clec4a2 G T 6: 123,139,125 E124* probably null Het
Cmtr1 T C 17: 29,702,255 V825A probably benign Het
Cnksr3 T C 10: 7,120,539 I232V probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col15a1 G T 4: 47,299,278 probably null Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cul1 A G 6: 47,520,830 N615S probably damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cyp2c67 C T 19: 39,617,367 G362S probably benign Het
D930048N14Rik T A 11: 51,653,865 probably benign Het
Ddx49 T C 8: 70,300,983 T79A probably damaging Het
Defb46 T A 8: 19,239,975 probably null Het
Dock8 A T 19: 25,127,128 I725F probably benign Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Enam T A 5: 88,504,465 S1278T possibly damaging Het
Fndc3a A G 14: 72,556,843 V829A probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gm10787 A T 10: 77,021,877 noncoding transcript Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gsap T A 5: 21,290,545 probably null Het
Gtf2ird1 T C 5: 134,382,580 probably null Het
Has3 A T 8: 106,874,079 I58F probably damaging Het
Haus5 A T 7: 30,658,501 probably null Het
Hip1r T C 5: 123,991,505 V169A probably benign Het
Hnf1a T A 5: 114,970,711 D45V probably damaging Het
Il20ra T A 10: 19,743,019 Y72N probably damaging Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Itpr1 T C 6: 108,386,706 L763P probably damaging Het
Katnal2 C A 18: 77,016,023 R104L probably benign Het
Kcng4 G T 8: 119,626,208 P321Q probably benign Het
Larp4b T C 13: 9,137,303 probably null Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lhcgr T A 17: 88,765,176 I148F probably damaging Het
Lsm10 T A 4: 126,097,963 S37R possibly damaging Het
Mfsd13a A G 19: 46,372,180 probably null Het
Mipep T A 14: 60,843,240 C560* probably null Het
Mme A G 3: 63,327,983 S97G probably benign Het
Mme G A 3: 63,328,046 D172N probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myt1l T C 12: 29,851,661 M208T probably benign Het
Neb T C 2: 52,228,542 I3987V probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Neto1 T C 18: 86,395,884 M1T probably null Het
Nom1 T C 5: 29,446,878 F738S possibly damaging Het
Olfr1137 T C 2: 87,710,973 probably null Het
Olfr1160 T G 2: 88,006,521 I86L probably damaging Het
Olfr1314 C A 2: 112,091,847 V285L probably benign Het
Olfr1420 C A 19: 11,896,885 P288H probably damaging Het
Olfr1487 C T 19: 13,619,603 S147F probably damaging Het
Olfr523 T A 7: 140,176,561 L147* probably null Het
Olfr572 C T 7: 102,928,441 S271L probably damaging Het
Olfr772 T C 10: 129,174,328 K231R probably benign Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Palb2 G T 7: 122,114,314 D915E possibly damaging Het
Pank4 T C 4: 154,976,359 L491P probably damaging Het
Paqr7 T C 4: 134,507,669 V279A probably benign Het
Pcif1 G A 2: 164,888,466 R373Q probably damaging Het
Pdgfa T A 5: 138,979,172 N185I probably benign Het
Plcd4 T C 1: 74,549,361 V123A possibly damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rac3 T G 11: 120,723,494 L148R possibly damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Rbl1 A G 2: 157,174,903 I592T probably benign Het
Rbl2 A C 8: 91,095,563 D408A possibly damaging Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Rorb A T 19: 18,962,083 L234H probably damaging Het
Rpp40 T G 13: 35,896,914 D279A probably benign Het
Siglec1 C A 2: 131,081,500 V442L probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skiv2l2 A T 13: 112,872,927 H979Q probably benign Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Sptbn5 T C 2: 120,071,644 I126M possibly damaging Het
Strada A G 11: 106,171,221 V94A possibly damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Tcrg-C3 A T 13: 19,261,091 M70L probably damaging Het
Tgm1 T C 14: 55,704,941 Y651C probably damaging Het
Tmem200c T A 17: 68,840,617 V65E probably damaging Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Vcan T G 13: 89,705,392 E483A probably damaging Het
Vmn2r124 A G 17: 18,063,174 T377A probably benign Het
Vmn2r3 A C 3: 64,259,394 I772S probably damaging Het
Wdfy3 A G 5: 101,915,376 V1342A probably benign Het
Zfp507 T C 7: 35,787,751 H764R probably damaging Het
Znrf3 A G 11: 5,287,455 I218T possibly damaging Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 118088214 missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 118043173 missense probably damaging 0.97
IGL00764:Dnah17 APN 11 118096485 missense probably damaging 0.99
IGL00795:Dnah17 APN 11 118093634 missense probably benign 0.35
IGL00823:Dnah17 APN 11 118047161 missense probably benign 0.22
IGL01145:Dnah17 APN 11 118047173 missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 118049934 missense probably damaging 1.00
IGL01454:Dnah17 APN 11 118058397 missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118119568 missense probably damaging 1.00
IGL01548:Dnah17 APN 11 118098612 missense probably benign 0.21
IGL01557:Dnah17 APN 11 118073686 missense probably damaging 0.98
IGL01632:Dnah17 APN 11 118033881 missense probably damaging 1.00
IGL01636:Dnah17 APN 11 118041056 missense probably benign 0.03
IGL01672:Dnah17 APN 11 118042160 missense probably damaging 0.97
IGL01822:Dnah17 APN 11 118081993 missense probably damaging 1.00
IGL01869:Dnah17 APN 11 118052676 missense probably benign 0.09
IGL01916:Dnah17 APN 11 118125288 missense probably benign 0.00
IGL02131:Dnah17 APN 11 118072908 missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118124261 missense probably benign 0.01
IGL02220:Dnah17 APN 11 118072967 nonsense probably null
IGL02454:Dnah17 APN 11 118080767 missense probably damaging 0.98
IGL02458:Dnah17 APN 11 118036350 missense probably damaging 1.00
IGL02588:Dnah17 APN 11 118025653 missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 118073548 missense probably damaging 1.00
IGL02881:Dnah17 APN 11 118042118 missense probably damaging 1.00
IGL02952:Dnah17 APN 11 118088268 missense probably benign 0.03
IGL03382:Dnah17 APN 11 118081943 missense probably damaging 1.00
IGL03389:Dnah17 APN 11 118094979 missense probably damaging 1.00
ergos UTSW 11 118041158 splice site probably benign
watt UTSW 11 118080766 missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 118098582 missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 118060092 missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 118074434 missense possibly damaging 0.82
R0116:Dnah17 UTSW 11 118058306 missense probably benign 0.01
R0157:Dnah17 UTSW 11 118127171 missense probably benign
R0320:Dnah17 UTSW 11 118052674 missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 118098539 missense probably benign 0.10
R0382:Dnah17 UTSW 11 118128996 missense probably damaging 1.00
R0383:Dnah17 UTSW 11 118067547 missense probably benign
R0400:Dnah17 UTSW 11 118082078 missense probably damaging 1.00
R0420:Dnah17 UTSW 11 118039939 missense probably damaging 1.00
R0483:Dnah17 UTSW 11 118047124 missense probably benign
R0533:Dnah17 UTSW 11 118110537 missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 118072900 missense probably damaging 1.00
R0564:Dnah17 UTSW 11 118082981 missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118121471 missense probably benign 0.00
R0608:Dnah17 UTSW 11 118090749 nonsense probably null
R0614:Dnah17 UTSW 11 118070568 splice site probably benign
R0632:Dnah17 UTSW 11 118067682 splice site probably benign
R0831:Dnah17 UTSW 11 118060271 missense probably damaging 0.99
R0838:Dnah17 UTSW 11 118060104 missense probably damaging 1.00
R0879:Dnah17 UTSW 11 118056835 splice site probably benign
R1061:Dnah17 UTSW 11 118052688 missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 118042175 missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118127137 critical splice donor site probably null
R1297:Dnah17 UTSW 11 118121366 splice site probably benign
R1332:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118125606 splice site probably benign
R1418:Dnah17 UTSW 11 118074023 missense probably damaging 0.98
R1432:Dnah17 UTSW 11 118023327 missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118114233 missense probably damaging 1.00
R1500:Dnah17 UTSW 11 118101053 missense probably benign
R1506:Dnah17 UTSW 11 118125387 missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 118095015 missense probably benign
R1567:Dnah17 UTSW 11 118125985 missense probably damaging 1.00
R1597:Dnah17 UTSW 11 118103498 splice site probably benign
R1665:Dnah17 UTSW 11 118121495 splice site probably benign
R1703:Dnah17 UTSW 11 118026749 missense probably damaging 1.00
R1716:Dnah17 UTSW 11 118032598 missense probably benign 0.00
R1727:Dnah17 UTSW 11 118070489 missense probably damaging 0.98
R1727:Dnah17 UTSW 11 118096536 nonsense probably null
R1728:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1869:Dnah17 UTSW 11 118047189 nonsense probably null
R1886:Dnah17 UTSW 11 118108161 missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 118066968 missense probably benign 0.00
R1954:Dnah17 UTSW 11 118024731 missense probably damaging 1.00
R1969:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1971:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1975:Dnah17 UTSW 11 118096536 nonsense probably null
R1977:Dnah17 UTSW 11 118112591 missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 118067531 missense probably benign 0.00
R2115:Dnah17 UTSW 11 118119802 missense probably benign 0.00
R2132:Dnah17 UTSW 11 118033747 missense probably damaging 0.98
R2200:Dnah17 UTSW 11 118102409 splice site probably benign
R2277:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118126384 critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118125974 missense probably benign 0.10
R2497:Dnah17 UTSW 11 118087024 synonymous probably null
R2923:Dnah17 UTSW 11 118093547 missense probably damaging 1.00
R3121:Dnah17 UTSW 11 118041086 missense probably damaging 1.00
R3236:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3237:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3498:Dnah17 UTSW 11 118080849 splice site probably benign
R3499:Dnah17 UTSW 11 118080849 splice site probably benign
R3746:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3749:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3762:Dnah17 UTSW 11 118104526 missense probably benign 0.00
R3826:Dnah17 UTSW 11 118041158 splice site probably benign
R3828:Dnah17 UTSW 11 118041158 splice site probably benign
R3829:Dnah17 UTSW 11 118041158 splice site probably benign
R3877:Dnah17 UTSW 11 118024707 missense probably damaging 1.00
R3899:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 118080849 splice site probably benign
R3913:Dnah17 UTSW 11 118080849 splice site probably benign
R3930:Dnah17 UTSW 11 118080849 splice site probably benign
R3931:Dnah17 UTSW 11 118080849 splice site probably benign
R3969:Dnah17 UTSW 11 118041158 splice site probably benign
R3970:Dnah17 UTSW 11 118041158 splice site probably benign
R4056:Dnah17 UTSW 11 118070538 missense probably benign 0.05
R4113:Dnah17 UTSW 11 118112594 missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118118772 missense probably damaging 1.00
R4324:Dnah17 UTSW 11 118094213 missense probably benign 0.01
R4412:Dnah17 UTSW 11 118073683 missense probably damaging 1.00
R4413:Dnah17 UTSW 11 118025168 missense probably benign 0.00
R4422:Dnah17 UTSW 11 118081973 missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 118052943 missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 118074293 missense probably benign 0.02
R4677:Dnah17 UTSW 11 118119814 missense probably damaging 1.00
R4716:Dnah17 UTSW 11 118073648 missense probably benign 0.02
R4832:Dnah17 UTSW 11 118026780 missense probably damaging 1.00
R4868:Dnah17 UTSW 11 118108212 missense probably benign 0.03
R4897:Dnah17 UTSW 11 118078593 missense probably damaging 1.00
R4928:Dnah17 UTSW 11 118027433 missense probably damaging 1.00
R4937:Dnah17 UTSW 11 118042154 missense probably damaging 1.00
R4957:Dnah17 UTSW 11 118074298 missense probably benign 0.44
R5008:Dnah17 UTSW 11 118110577 missense probably benign 0.01
R5016:Dnah17 UTSW 11 118080766 missense probably damaging 0.96
R5027:Dnah17 UTSW 11 118102539 missense probably benign 0.01
R5133:Dnah17 UTSW 11 118117113 missense probably benign 0.00
R5140:Dnah17 UTSW 11 118086945 missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118114179 missense probably damaging 0.99
R5151:Dnah17 UTSW 11 118027467 missense probably damaging 1.00
R5153:Dnah17 UTSW 11 118082974 nonsense probably null
R5192:Dnah17 UTSW 11 118034359 missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118112514 missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118117203 intron probably benign
R5396:Dnah17 UTSW 11 118127282 missense probably benign
R5418:Dnah17 UTSW 11 118094984 missense probably benign 0.04
R5534:Dnah17 UTSW 11 118052770 missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 118073660 missense probably benign 0.03
R5594:Dnah17 UTSW 11 118043229 splice site probably null
R5634:Dnah17 UTSW 11 118052926 splice site probably null
R5696:Dnah17 UTSW 11 118101056 missense probably benign 0.44
R5802:Dnah17 UTSW 11 118036446 missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 118034367 missense probably damaging 1.00
R5873:Dnah17 UTSW 11 118056897 missense probably benign 0.01
R5898:Dnah17 UTSW 11 118114213 missense probably benign 0.00
R5934:Dnah17 UTSW 11 118041102 missense probably benign
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6113:Dnah17 UTSW 11 118126275 missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118119571 missense probably benign 0.00
R6137:Dnah17 UTSW 11 118025654 missense probably damaging 1.00
R6173:Dnah17 UTSW 11 118039946 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126323 nonsense probably null
R6258:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126323 nonsense probably null
R6260:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6278:Dnah17 UTSW 11 118126290 missense probably damaging 0.99
R6298:Dnah17 UTSW 11 118108161 missense probably benign 0.00
R6300:Dnah17 UTSW 11 118034310 missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118129155 missense probably benign 0.09
R6363:Dnah17 UTSW 11 118110505 missense probably benign
R6381:Dnah17 UTSW 11 118129185 missense probably benign 0.08
R6418:Dnah17 UTSW 11 118129197 missense probably damaging 0.99
R6660:Dnah17 UTSW 11 118100188 missense probably benign
R6803:Dnah17 UTSW 11 118125372 missense probably benign 0.00
R6820:Dnah17 UTSW 11 118069000 missense probably damaging 0.99
R6885:Dnah17 UTSW 11 118090772 missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 118041484 missense probably damaging 0.98
R6932:Dnah17 UTSW 11 118060079 missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 118066432 missense probably damaging 1.00
R7000:Dnah17 UTSW 11 118025702 critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118118871 missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 118046118 missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118125386 missense probably benign
R7131:Dnah17 UTSW 11 118079658 missense probably benign 0.14
R7143:Dnah17 UTSW 11 118086130 missense probably damaging 1.00
R7146:Dnah17 UTSW 11 118082110 missense probably damaging 0.98
R7147:Dnah17 UTSW 11 118094929 missense probably benign 0.31
R7172:Dnah17 UTSW 11 118041131 nonsense probably null
R7183:Dnah17 UTSW 11 118129188 missense probably benign
R7297:Dnah17 UTSW 11 118055730 critical splice donor site probably null
R7297:Dnah17 UTSW 11 118103356 missense probably damaging 0.98
R7367:Dnah17 UTSW 11 118115196 missense probably benign
R7398:Dnah17 UTSW 11 118080724 missense probably damaging 0.96
R7426:Dnah17 UTSW 11 118090717 missense probably null 0.79
R7524:Dnah17 UTSW 11 118121481 missense not run
R7529:Dnah17 UTSW 11 118049866 critical splice donor site unknown
X0058:Dnah17 UTSW 11 118082925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTTCTTAGCTCCCCGGG -3'
(R):5'- AACTGCTGTGAAGGGTACGG -3'

Sequencing Primer
(F):5'- CGGGACTACCTGTCACTCAC -3'
(R):5'- CTGTGAAGGGTACGGGCACTG -3'
Posted On2014-06-23