Incidental Mutation 'R1852:Vcan'
ID208250
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Nameversican
SynonymsPG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
MMRRC Submission 039876-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1852 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location89655312-89742509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89705392 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 483 (E483A)
Ref Sequence ENSEMBL: ENSMUSP00000105171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109544
AA Change: E483A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614
AA Change: E483A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109546
AA Change: E483A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: E483A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,268,473 D499G probably damaging Het
2900092C05Rik A G 7: 12,512,702 probably null Het
4930433I11Rik T A 7: 40,993,613 D326E probably benign Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Abca8a T C 11: 110,069,386 D676G probably damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acsl6 T C 11: 54,361,076 I683T probably damaging Het
Adgrg5 A T 8: 94,937,800 Y345F probably damaging Het
Alg6 T G 4: 99,746,362 F114V probably benign Het
Ank2 A C 3: 126,997,851 probably null Het
Ankrd24 A T 10: 81,642,941 probably benign Het
Ano8 T C 8: 71,483,487 K222E probably damaging Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Bmpr1b A T 3: 141,857,402 probably null Het
C3 A G 17: 57,222,823 V2A probably damaging Het
Capn1 A G 19: 6,009,103 V276A possibly damaging Het
Ccdc57 T C 11: 120,921,673 E85G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chl1 A T 6: 103,699,159 probably null Het
Chodl C T 16: 78,941,258 P38L probably benign Het
Clec4a2 G T 6: 123,139,125 E124* probably null Het
Cmtr1 T C 17: 29,702,255 V825A probably benign Het
Cnksr3 T C 10: 7,120,539 I232V probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col15a1 G T 4: 47,299,278 probably null Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cul1 A G 6: 47,520,830 N615S probably damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cyp2c67 C T 19: 39,617,367 G362S probably benign Het
D930048N14Rik T A 11: 51,653,865 probably benign Het
Ddx49 T C 8: 70,300,983 T79A probably damaging Het
Defb46 T A 8: 19,239,975 probably null Het
Dnah17 T A 11: 118,121,916 I145F probably damaging Het
Dock8 A T 19: 25,127,128 I725F probably benign Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Enam T A 5: 88,504,465 S1278T possibly damaging Het
Fndc3a A G 14: 72,556,843 V829A probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gm10787 A T 10: 77,021,877 noncoding transcript Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gsap T A 5: 21,290,545 probably null Het
Gtf2ird1 T C 5: 134,382,580 probably null Het
Has3 A T 8: 106,874,079 I58F probably damaging Het
Haus5 A T 7: 30,658,501 probably null Het
Hip1r T C 5: 123,991,505 V169A probably benign Het
Hnf1a T A 5: 114,970,711 D45V probably damaging Het
Il20ra T A 10: 19,743,019 Y72N probably damaging Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Itpr1 T C 6: 108,386,706 L763P probably damaging Het
Katnal2 C A 18: 77,016,023 R104L probably benign Het
Kcng4 G T 8: 119,626,208 P321Q probably benign Het
Larp4b T C 13: 9,137,303 probably null Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lhcgr T A 17: 88,765,176 I148F probably damaging Het
Lsm10 T A 4: 126,097,963 S37R possibly damaging Het
Mfsd13a A G 19: 46,372,180 probably null Het
Mipep T A 14: 60,843,240 C560* probably null Het
Mme A G 3: 63,327,983 S97G probably benign Het
Mme G A 3: 63,328,046 D172N probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myt1l T C 12: 29,851,661 M208T probably benign Het
Neb T C 2: 52,228,542 I3987V probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Neto1 T C 18: 86,395,884 M1T probably null Het
Nom1 T C 5: 29,446,878 F738S possibly damaging Het
Olfr1137 T C 2: 87,710,973 probably null Het
Olfr1160 T G 2: 88,006,521 I86L probably damaging Het
Olfr1314 C A 2: 112,091,847 V285L probably benign Het
Olfr1420 C A 19: 11,896,885 P288H probably damaging Het
Olfr1487 C T 19: 13,619,603 S147F probably damaging Het
Olfr523 T A 7: 140,176,561 L147* probably null Het
Olfr572 C T 7: 102,928,441 S271L probably damaging Het
Olfr772 T C 10: 129,174,328 K231R probably benign Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Palb2 G T 7: 122,114,314 D915E possibly damaging Het
Pank4 T C 4: 154,976,359 L491P probably damaging Het
Paqr7 T C 4: 134,507,669 V279A probably benign Het
Pcif1 G A 2: 164,888,466 R373Q probably damaging Het
Pdgfa T A 5: 138,979,172 N185I probably benign Het
Plcd4 T C 1: 74,549,361 V123A possibly damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rac3 T G 11: 120,723,494 L148R possibly damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Rbl1 A G 2: 157,174,903 I592T probably benign Het
Rbl2 A C 8: 91,095,563 D408A possibly damaging Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Rorb A T 19: 18,962,083 L234H probably damaging Het
Rpp40 T G 13: 35,896,914 D279A probably benign Het
Siglec1 C A 2: 131,081,500 V442L probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skiv2l2 A T 13: 112,872,927 H979Q probably benign Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Sptbn5 T C 2: 120,071,644 I126M possibly damaging Het
Strada A G 11: 106,171,221 V94A possibly damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Tcrg-C3 A T 13: 19,261,091 M70L probably damaging Het
Tgm1 T C 14: 55,704,941 Y651C probably damaging Het
Tmem200c T A 17: 68,840,617 V65E probably damaging Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Vmn2r124 A G 17: 18,063,174 T377A probably benign Het
Vmn2r3 A C 3: 64,259,394 I772S probably damaging Het
Wdfy3 A G 5: 101,915,376 V1342A probably benign Het
Zfp507 T C 7: 35,787,751 H764R probably damaging Het
Znrf3 A G 11: 5,287,455 I218T possibly damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0139:Vcan UTSW 13 89691261 missense probably damaging 1.00
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1824:Vcan UTSW 13 89705212 missense possibly damaging 0.75
R1868:Vcan UTSW 13 89690871 missense probably benign 0.12
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1932:Vcan UTSW 13 89705534 missense possibly damaging 0.78
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1942:Vcan UTSW 13 89703424 missense probably benign 0.01
R1964:Vcan UTSW 13 89692742 missense probably benign 0.02
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R4973:Vcan UTSW 13 89688842 missense probably benign 0.30
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
R6994:Vcan UTSW 13 89693407 missense possibly damaging 0.94
R6997:Vcan UTSW 13 89690618 missense probably damaging 0.98
R7029:Vcan UTSW 13 89690241 missense probably damaging 1.00
R7066:Vcan UTSW 13 89705686 missense probably damaging 1.00
R7156:Vcan UTSW 13 89689110 missense possibly damaging 0.95
R7171:Vcan UTSW 13 89725591 missense probably damaging 1.00
R7176:Vcan UTSW 13 89688936 missense probably benign 0.01
R7229:Vcan UTSW 13 89705270 missense possibly damaging 0.87
R7250:Vcan UTSW 13 89721686 missense probably damaging 1.00
R7250:Vcan UTSW 13 89731457 critical splice donor site probably null
R7262:Vcan UTSW 13 89705161 missense possibly damaging 0.62
R7289:Vcan UTSW 13 89692733 nonsense probably null
R7299:Vcan UTSW 13 89705266 missense probably benign
R7301:Vcan UTSW 13 89705266 missense probably benign
R7425:Vcan UTSW 13 89689832 missense probably damaging 0.99
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCATAGTGACTTGTGGTTGCC -3'
(R):5'- CAGATTAGCCATGGAATCACCC -3'

Sequencing Primer
(F):5'- AATTCAGGACTGGCGCTTAC -3'
(R):5'- TGGAATCACCCACAACTACTCGG -3'
Posted On2014-06-23